description

HNH nuclease-like protein, rescues AddA-AddB-mediated recombination intermediates

HNH nuclease-like protein, rescues [[protein|AddA]]-[[protein|AddB]]-mediated recombination intermediates

function

rescuing of AddA-AddB-mediated recombination intermediates

rescuing of [[protein|AddA]]-[[protein|AddB]]-mediated recombination intermediates

ec

Gene

Phenotypes of a mutant

essential, the mutation can be suppressed by second-site mutations in ''[[gene|addA]]'' or ''[[gene|addB]]'' [Pubmed|22984257], non-essential according to [Pubmed|28189581]

essential, the mutation can be suppressed by second-site mutations in [[gene|addA]] or [[gene|addB]] [Pubmed|22984257], non-essential according to [Pubmed|28189581]

Biological materials

Mutant

MGNA-A503 (yisB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/503 NBRP B. subtilis, Japan]

BKE10660 ([[gene|hlpB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTTGCCATATCCGCTC, downstream forward: _UP4_TGACTAAAAAGCAGCCCTCT

BKK10660 ([[gene|hlpB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTTGCCATATCCGCTC, downstream forward: _UP4_TGACTAAAAAGCAGCCCTCT

GP3559 (Δ[[gene|hlpB]]::kan), available in [SW|Jörg Stülke]'s lab

MGNA-A503 (yisB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/503 NBRP B. subtilis, Japan]

BKE10660 ([[gene|hlpB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTTGCCATATCCGCTC, downstream forward: _UP4_TGACTAAAAAGCAGCCCTCT

BKK10660 ([[gene|hlpB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTTGCCATATCCGCTC, downstream forward: _UP4_TGACTAAAAAGCAGCCCTCT

The protein

Paralogous protein(s)

[[this]]