SubtiBank SubtiBank
Version comparison:

Wed Mar 09 2016 16:15:47 GMT+0100 (CET)2025-05-30 03:19:53

description

transcriptional regulator (Xre family) of post-exponential-phase responses genes

transcriptional regulator ([SW|Xre family]) of post-exponential-phase responses genes

locus

BSU24610

BSU_24610

function

control of biofilm formation

control of [SW|biofilm formation]

product

transcriptional regulator (Xre family)

transcriptional regulator ([SW|Xre family])

ec

outlinks

bsu

BSU24610

BSU_24610

[SW|Categories] containing this gene/protein

[SW|transcription factors and their control], [SW|transition state regulators], [SW|biofilm formation]

Gene

Coordinates on the chromosome (coding sequence)

2,552,653 -> 2,552,988

Gene

Phenotypes of a mutant

the mutation suppresses the galactose toxicity to a'' [[protein|galE]]'' mutant [Pubmed|22893383]

the mutation suppresses the galactose toxicity to a'' [[gene|galE]]'' mutant [Pubmed|22893383]

The protein

Catalyzed reaction/ biological activity

transcription regulator of biofilm genes, acts as a true repressor of the ''[[protein|tapA]]-[[protein|sipW]]-[[protein|tasA]]'' operon and as an anti-activator (prevents binding of the activator protein [[protein|RemA]]) of the ''[[protein|epsA]]-[[protein|epsB]]-[[protein|epsC]]-[[protein|epsD]]-[[protein|epsE]]-[[protein|epsF]]-[[protein|epsG]]-[[protein|epsH]]-[[protein|epsI]]-[[protein|epsJ]]-[[protein|epsK]]-[[protein|epsL]]-[[protein|epsM]]-[[protein|epsN]]-[[protein|epsO]]'' operon [Pubmed|23646920]

acts as co-repressor for [[protein|SlrR]] [Pubmed|20351052]

transcription regulator of biofilm genes, acts as a true repressor of the ''[[gene|tapA]]-[[gene|sipW]]-[[gene|tasA]]'' operon and as an anti-activator (prevents binding of the activator protein [[protein|RemA]]) of the ''[[gene|epsA]]-[[gene|epsB]]-[[gene|epsC]]-[[gene|epsD]]-[[gene|epsE]]-[[gene|epsF]]-[[gene|epsG]]-[[gene|epsH]]-[[gene|epsI]]-[[gene|epsJ]]-[[gene|epsK]]-[[gene|epsL]]-[[gene|epsM]]-[[gene|epsN]]-[[gene|epsO]]'' operon [Pubmed|23646920]

acts as co-repressor for [[protein|SlrR]] [Pubmed|20351052]

The protein

Paralogous protein(s)

[[protein|SlrR]]

[[this]]

The protein

[SW|Domains]

DNA-binding N-terminal domain (aa 1-69) [Pubmed|21708175]

[[protein|SinI]]-binding C-terminal domain (aa 74-111) [Pubmed|21708175]

DNA-binding N-terminal domain (aa 1-69) [Pubmed|21708175]

[[protein|SinI]]-binding C-terminal domain (aa 74-111) [Pubmed|21708175]

[SW|HTH cro/C1-type domain] (aa 6-61) (according to UniProt)

[SW|Sin domain] (aa 65-103) (according to UniProt)

The protein

[SW|Interactions]

[[protein|SlrA]]-[[protein|SinR]] [Pubmed|19788541], K(D) 10.6 nM [Pubmed|23430750]

[[protein|SlrR]]-[[protein|SinR]] [Pubmed|20351052], K(D) 47.5 nM [Pubmed|23430750], [[protein|Veg]] may inhibit this interaction [Pubmed|23378512]

[[protein|SinR]]-[[protein|SinI]] [Pubmed|9799632], K(D) 1.8 nM [Pubmed|23430750]

[[protein|SinR]]-[[protein|ScoC]]

Expression and Regulation

Operon

''[[protein|sinI]]-[[protein|sinR]]'' [Pubmed|3125149]

''[[protein|sinR]]'' [Pubmed|3125149]

Expression and Regulation

[SW|Sigma factor]

''[[protein|sinI]]'': [[protein|SigA]] [Pubmed|3125149]

''[[protein|sinR]]'': [[protein|SigA]] [Pubmed|3125149]

Expression and Regulation

Regulation

''[[protein|sinI]]'': repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|11751836]

''[[protein|sinI]]'': repressed during exponential growth ([[protein|ScoC]]) [http://www.ncbi.nlm.nih.gov/sites/entrez/1906467,11751836 PubMed]

''[[protein|sinI]]'': repressed during logrithmic growth ([[protein|AbrB]]) [http://www.ncbi.nlm.nih.gov/sites/entrez/7635837,11751836 PubMed]

''[[protein|sinI]]'': repressed during vegetative growth ([[protein|SinR]]) [Pubmed|1664536]

''[[protein|sinR]]'' is bimodally expressed and this depends on [[rny|RNase Y]] [Pubmed|26819068]

Expression and Regulation

Regulatory mechanism

[SW|Spo0A]: transcription repression [Pubmed|11751836]

[[protein|ScoC]]: transcription repression [http://www.ncbi.nlm.nih.gov/sites/entrez/1906467,11751836 PubMed]

[[protein|AbrB]]: transcription repression [http://www.ncbi.nlm.nih.gov/sites/entrez/7635837,11751836 PubMed]

[[protein|SinR]]: transcription repression [Pubmed|1664536]

Expression and Regulation

Additional information

the mRNA is substantially stabilized upon depletion of [[Rny|RNase Y]] (the half-life of the mRNA increases from 3.5 to 13 min) [PubMed|21815947]

Biological materials

Mutant

GP923 (''sinR::spec'') [Pubmed|21856853], available in [SW|Jörg Stülke]'s lab

GP736 (''sinR::tetR'') [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab

1S97 (''sinR''::''phleo''), [Pubmed|8422983], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S97&Search=1S97 BGSC]

GP1672 (''[[protein|sinR]]-[[protein|tasA]]''::''cat'') [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab

GP1663 (''[[protein|yqhG]]-[[protein|sinI]]-[[protein|sinR]]-[[protein|tasA]]''), available in [SW|Jörg Stülke]'s lab

GP923 (''sinR::spec'') [Pubmed|21856853], available in [SW|Jörg Stülke]'s lab

GP736 (''sinR::tetR'') [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab

1S97 (''sinR''::''phleo''), [Pubmed|8422983], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S97&Search=1S97 BGSC]

GP1672 (''[[gene|sinR]]-[[gene|tasA]]''::''cat'') [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab

GP1663 (''[[gene|yqhG]]-[[gene|sinI]]-[[gene|sinR]]-[[gene|tasA]]''), available in [SW|Jörg Stülke]'s lab

BKE24610 ([[gene|sinR]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATCACCTTCCTTG, downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC

BKK24610 ([[gene|sinR]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATCACCTTCCTTG, downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC

Biological materials

Expression vector

N-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP380]: pGP1083 , available in [SW|Jörg Stülke]'s lab

Biological materials

lacZ fusion

pGP1930 (aphA3) based on [[protein|pAC7]], available in [SW|Jörg Stülke]'s lab

pGP1930 (aphA3) based on [SW|pAC7], available in [SW|Jörg Stülke]'s lab

References

Reviews

20395361, 20541494, 23353768, 24988880

20395361, 20541494, 23353768, 24988880, 30218468, 30482826

References

Original publications

22893383, 23378512, 23430750, 23475644, 21856853, 21815947, 22329926, 21326214, 21708175, 8955328, 15661000, 8878039, 24317403, 16923912, 15104138, 16430695, 16430696, 18047568, 18430133, 1906467, 7635837, 11751836, 19201793, 10547280, 15104138, 9799632, 19788541, 19898538, 3125149, 8932324, 20351052, 20923420, 8422983, 9685500, 9158733, 23646920, 23660663, 24256735, 24347549, 25433524, 26283769, 26819068

22893383, 23378512, 23430750, 23475644, 21856853, 21815947, 22329926, 21326214, 21708175, 8955328, 15661000, 8878039, 24317403, 16923912, 15104138, 16430695, 16430696, 18047568, 18430133, 1906467, 7635837, 11751836, 19201793, 10547280, 9799632, 19788541, 19898538, 3125149, 8932324, 20351052, 20923420, 8422983, 9685500, 9158733, 23646920, 23660663, 24256735, 24347549, 25433524, 26283769, 26819068, 26434553, 28546427, 29321771, 30181249, 30326845, 30396900, 31493408, 31604312

proteinLength

111

geneLength

336

Gene

Coordinates

2,552,653 2,552,988

The protein

additional information

information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000086 PRODORIC2 database]

Expression and Regulation

Operons

[[this]]

Expression and Regulation

Other regulations

[[this]]

Biological materials

Expression vectors

N-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP380]: pGP1083 , available in [SW|Jörg Stülke]'s lab

pGP2330: in [SW|pBQ200], for expression in B. subtilis, available in [SW|Jörg Stülke]'s lab