SubtiBank SubtiBank
Version comparison:

2018-06-29 15:00:062017-8-11 16:0:3

Biological materials

Mutant

MGNA-A915 (yeaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/915 NBRP B. subtilis, Japan]

GP1119 (spc), available in the [SW|Stülke] lab

BKE06330 (Δ[[gene|yeaC]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCTCCTAGTCA, downstream forward: _UP4_GTTCAAAGGTCGGCGGTCCG

BKK06330 (Δ[[gene|yeaC]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCTCCTAGTCA, downstream forward: _UP4_GTTCAAAGGTCGGCGGTCCG

MGNA-A915 (yeaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/915 NBRP B. subtilis, Japan]

GP1119 (spc), available in the [SW|Stülke] lab