mutTA

rppH

error prevention oxidized guanine system, confers protection against oxidative stress to vegetative cells, moreover the protein has RNA pyrophosphohydrolase activity

decapping of NAD-capped RNAs, error prevention oxidized guanine system, confers protection against oxidative stress to vegetative cells, moreover the protein has RNA pyrophosphohydrolase activity

BSU30630

BSU_30630

474

477

mutTA

ytkD

rppH

mutTA

ytkD

BSU30630

BSU_30630

3,134,983 → 3,135,459

3,134,983 3,135,459

removal of pyrophosphate from the 5' end of mRNAs to make the RNA accessible for degradation by [SW|RNases] [Pubmed|21925382]

RppH requires at least two unpaired nucleotides at the 5' end of its RNA substrates and prefers three or more. The second of these 5'-terminal nucleotides must be G, whereas a less strict preference for a purine is evident at the third position, and A is slightly favored over G at the first position [Pubmed|23610425,23610407]

removal of pyrophosphate from the 5' end of mRNAs to make RNA accessible for degradation by [SW|RNases] [Pubmed|21925382]

RppH requires at least two unpaired nucleotides at the 5' end of its RNA substrates and prefers three or more. The second of these 5'-terminal nucleotides must be G, whereas a less strict preference for a purine is evident at the third position, and A is slightly favored over G at the first position [Pubmed|23610425,23610407]

decapping of NAD-capped RNAs [pubmed|30110644]

8-oxo-dGTP + H₂O --> 8-oxo-dGMP + diphosphate + H⁺ (according to UniProt)

[SW|Nudix hydrolase] family (according to Swiss-Prot)

[SW|Nudix hydrolase] (according to UniProt)

MGNA-A297 (ytkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/297 NBRP B. subtilis, Japan]

MGNA-A297 (ytkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/297 NBRP B. subtilis, Japan]

BKE30630 ([[gene|rppH]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCAAATCC, downstream forward: _UP4_TAAAAAACCCGGCACATGTG

BKK30630 ([[gene|rppH]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCAAATCC, downstream forward: _UP4_TAAAAAACCCGGCACATGTG

22568516

22568516, 32061882

16513759, 16497325, 14761999, 19011023, 9387221, 15576788, 21925382, 23610425, 23610407

16513759, 16497325, 14761999, 19011023, 9387221, 15576788, 21925382, 23610425, 23610407, 30110644

[[this]]

[SW|Nudix hydrolase domain] (aa 6-145) (according to UniProt)