SubtiBank SubtiBank
Version comparison:

2019-02-19 19:04:322018-12-07 15:39:06

geneLength

1950

1947

Gene

Coordinates

842,047 843,996

842,047 → 843,996

Gene

Phenotypes of a mutant

induction of [[protein|SigM]] and [[protein|SigX]] activities [Pubmed|23103977]

reduced [[protein|SigD]]-dependent expression of ''[[gene|lytF]]'' [Pubmed|25288647]

extended lag phase [pubmed|29114240]

reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]

suppression of the growth and morphology defects of a [[gene|glmR]] mutant [pubmed|30478337]

induction of [[protein|SigM]] and [[protein|SigX]] activities [Pubmed|23103977]

reduced [[protein|SigD]]-dependent expression of ''[[gene|lytF]]'' [Pubmed|25288647]

extended lag phase [pubmed|29114240]

reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]

The protein

Modification

phosphorylated on Thr-297 [Pubmed|19229300]

can be phosphorylated by [[protein|PrkC]] in vitro [pubmed|30478337]

phosphorylated on Thr-297 [Pubmed|19229300]

Biological materials

Mutant

MGNA-C256 (yflE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2254 NBRP B. subtilis, Japan]

GP1389 ''ltaS::aphA3'', available in [SW|Jrg Stlke]'s lab

GP1396 ''ltaS::tet'', available in [SW|Jrg Stlke]'s lab

BKE07710 ([[gene|ltaS]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTACACTCCTTTTTT, downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT

BKK07710 ([[gene|ltaS]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTACACTCCTTTTTT, downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT

MGNA-C256 (yflE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2254 NBRP B. subtilis, Japan]

GP1389 ''ltaS::aphA3'', available in [SW|Jörg Stülke]'s lab

GP1396 ''ltaS::tet'', available in [SW|Jörg Stülke]'s lab

BKE07710 (Δ[[gene|ltaS]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTACACTCCTTTTTT, downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT

BKK07710 (Δ[[gene|ltaS]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTACACTCCTTTTTT, downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT

References

Original publications

19229300, 17483484, 21255105, 19168632, 15743965, 23103977, 25288647, 29114240, 30478337

19229300, 17483484, 21255105, 19168632, 15743965, 23103977, 25288647, 29114240