SubtiBank SubtiBank
Version comparison:

2018-02-12T04:15:13.000Z2017-8-11 16:0:3

Biological materials

Mutant

MGNA-B154 (yjbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1153 NBRP B. subtilis, Japan]

1A823 ( ''pepF''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A823&Search=1A823 BGSC]

BKE11540 (Δ[[gene|pepF]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCCTGCCCACCACCTT, downstream forward: _UP4_TAAAAAAGTAAGCCTGTGCG

BKK11540 (Δ[[gene|pepF]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCCTGCCCACCACCTT, downstream forward: _UP4_TAAAAAAGTAAGCCTGTGCG

MGNA-B154 (yjbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1153 NBRP B. subtilis, Japan]

1A823 ( ''pepF''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A823&Search=1A823 BGSC]