RNA polymerase ECF-type sigma factor SigW, required for the adaptation to membraneactive agents, activated by alkaline shock and by polymyxin B, vancomycin, cephalosporin C, D-cycloserine, and triton X-100

[SW|RNA polymerase] ECF-type [SW|sigma factor] SigW, required for the adaptation to membrane active agents, activated by alkaline shock and by polymyxin B, vancomycin, cephalosporin C, D-cycloserine, and triton X-100

BSU01730

BSU_01730

RNA polymerase ECF-type sigma factor SigW

[SW|RNA polymerase] ECF-type [SW|sigma factor] SigW

BSU01730

BSU_01730

[SW|transcription], [SW|sigma factors and their control], [SW|cell envelope stress proteins (controlled by SigM, V, W, X, Y)]

194,849 -> 195,412

sensitive to ß-lactam antibiotics such as cefuroxime and to fosfomycin [Pubmed|22178969]

Inactivation of ''[[protein|alsR]]'', ''[[protein|sigD]]'' and ''[[protein|sigW]]'' increases competitive fitness of ''Bacillus subtilis'' under non-sporulating conditions [Pubmed|22344650]

sensitive to -lactam antibiotics such as cefuroxime and to fosfomycin [Pubmed|22178969]

Inactivation of ''[[gene|alsR]]'', ''[[gene|sigD]]'' and ''[[gene|sigW]]'' increases competitive fitness of ''Bacillus subtilis'' under non-sporulating conditions [Pubmed|22344650]

ECF subfamily (according to Swiss-Prot)

[SW|Sigma-70 factor family] (according to UniProt)

[SW|ECF subfamily] (according to UniProt)

[[protein|RsiW]]-[[protein|SigW]] [Pubmed|14993308]

[[protein|SigW]]-[[protein|RpoB]]-[[protein|RpoC]]

''[[protein|sigW]]-[[protein|rsiW]]'' [Pubmed|12207695]

[[protein|SigW]] [Pubmed|12207695]

induced under conditions of alkali shock or in the presence of the toxin [[protein|SdpC]] ([[protein|SigW]]) [Pubmed|12207695]

repressed during logrithmic growth ([[protein|AbrB]]) [Pubmed|12076816]

[[protein|AbrB]]: transcription repression [Pubmed|12076816]

1A905 ( ''sigW''::''erm''), [Pubmed|11244082], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A905&Search=1A905 BGSC]

1A905 ( ''sigW''::''erm''), [Pubmed|11244082], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A905&Search=1A905 BGSC]

BKE01730 ([[gene|sigW]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTATCTAACCTCTGC, downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG

BKK01730 ([[gene|sigW]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTATCTAACCTCTGC, downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG

[SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]

[SW|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas Wiegert-Dateien/Thomas Wiegert.html Homepage]

22381678, 24921931, 26901131, 27344142

22381678, 24921931, 26901131, 27344142, 29343670

11222589, 14993308, 16816000, 17338440, 12207695, 11454200, 14563871, 12076816, 19820159, 21821766, 22344650, 14993308, 23185515, 20817771, 21542858, 22178969, 27137497

11222589, 14993308, 16816000, 17338440, 12207695, 11454200, 14563871, 12076816, 19820159, 21821766, 22344650, 14993308, 23185515, 20817771, 21542858, 22178969, 27137497, 27977677, 28319136, 29454936, 31461489

187

564

194,849 195,412

[[this]]

[PDB|5WUQ] (complex with the cytoplasmic domain of [[protein|RsiW]]) [pubmed|28319136]

[[this]]

[[this]]

[SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]

[SW|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas Wiegert-Dateien/Thomas Wiegert.html Homepage]