[SW|trigger enzyme],beta-glucoside uptake and control of [[protein|LicT ]]activity

beta-glucoside permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBCA of the [[category|Phosphotransferase system|PTS]], [[category|Trigger enzyme]], control of [[protein|LicT ]]activity

BSU39270

BSU_39270

1827

1830

[SW|trigger enzyme]

beta-glucoside permease of the [SW|phosphotransferase systems|phosphotransferase system]

BSU39270

BSU_39270

4,033,778 → 4,035,607

4,033,778 4,035,607

Protein EIIA N(pi)-phospho-L-histidine + protein EIIB = protein EIIA + protein EIIB N(pi)-phospho-L-histidine/cysteine (according to Swiss-Prot)

PTS permease, sucrose permease (Scr) family [Pubmed|10627040]

[[category|Phosphotransferase system|PTS]] permease, sucrose family [Pubmed|10627040]

GP475 (erm), available in the [SW|Stülke] lab

GP475 (erm), available in [SW|Jörg Stülke]'s lab [pubmed|23475962]

BKE39270 ([[gene|bglP]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATACCTCCTTTTT, downstream forward: _UP4_TGAAAAAACTAATGGGGTGA

BKK39270 ([[gene|bglP]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATACCTCCTTTTT, downstream forward: _UP4_TGAAAAAACTAATGGGGTGA

pGP1290 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Stülke] lab,

pGP1300 (expression of ''[[gene|bglP]]'' in ''B. subtilis'', in [SW|pBQ200]), available in [SW|Stülke] lab

pGP600 (in [[protein|pAC6]]), available in [SW|Stülke] lab

pGP600 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab

[[this]]

[SW|PTS EIIA domain] type-1 (aa 480-584) (according to UniProt)

[SW|PTS EIIB domain] type-1 (aa 1-86) (according to UniProt)

[SW|PTS EIIC domain] type-1 (aa 103-459) (according to UniProt)

pGP1290 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab,

pGP1300 (expression of ''[[gene|bglP]]'' in ''B. subtilis'', in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

GP1266, [[gene|bglP]]-cfp, available in [SW|Jörg Stülke]'s lab [pubmed|23475962]