Sat Apr 30 2016 19:53:12 GMT+0200 (CEST)2025-05-28 22:24:03
locus
BSU09420
BSU_09420
outlinks
bsu
BSU09420
BSU_09420
[SW|Categories] containing this gene/protein
[SW|cell wall degradation/ turnover], [SW|cell wall synthesis]
Gene
Coordinates on the chromosome (coding sequence)
1,018,998 -> 1,020,002
Gene
Phenotypes of a mutant
a ''[[protein|cwlO]] [[protein|lytE]]'' mutant is not viable [Pubmed|17581128,22139507]
growth defect at high temperature [Pubmed|21541672]
inactivation of ''[[protein|lytE]]'' strongly restores beta-lactam resistance in a ''[[protein|sigM]]'' mutant by delaying cell lysis [Pubmed|22211522]
a ''[[protein|lytE]]'' mutation is synthetically lethal with ''[[protein|ftsE]]'' and ''[[protein|ftsX]]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]
a ''[[protein|lytE]]'' mutation increases the cell separation defect of a ''[[protein|lytF]]'' mutant [Pubmed|23855774]
cells are thinner (reduced diameter) as compared to the wild type [Pubmed|23869552]
a ''[[gene|cwlO]] [[gene|lytE]]'' mutant is not viable [Pubmed|17581128,22139507]
a [[gene|ugtP]] [[gene|lytE]] double mutant has a severe [SW|cell shape] defect, thi can be suppressed by mutations resulting in reduced expression or activity of [[protein|PonA|PbpA]] [pubmed|33087775]
growth defect at high temperature [Pubmed|21541672]
inactivation of ''[[gene|lytE]]'' strongly restores beta-lactam resistance in a ''[[gene|sigM]]'' mutant by delaying cell lysis [Pubmed|22211522]
synthetically lethal with ''[[gene|ftsE]]'' and ''[[gene|ftsX]]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]
synthetically lethal with [[gene|sweC]] and [[gene|sweD]], this can be suppressed by point mutations in [[gene|ftsE]] or [[gene|ftsX]] [pubmed|31437162]
a ''[[gene|lytE]]'' mutation increases the cell separation defect of a ''[[gene|lytF]]'' mutant [Pubmed|23855774]
cells are thinner (reduced diameter) as compared to the wild type [Pubmed|23869552]
reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]
The protein
Catalyzed reaction/ biological activity
cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
degradation of gamma-polyglutamic acid [pubmed|29458655]
The protein
Protein family
nlpC/p60 family (according to Swiss-Prot)
[SW|Peptidase C40 family] (according to UniProt)
The protein
Paralogous protein(s)
the C-terminal D,L-endopeptidase domains of [[protein|LytE]], [[protein|LytF]], [[protein|CwlS]], and [[protein|CwlO]] exhibit strong sequence similarity
[[this]]
The protein
[SW|Domains]
contains three N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]
C-terminal D,L-endopeptidase domain [Pubmed|22139507]
contains three N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]
C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
3 [SW|LysM domain]s (aa 26-69, aa 86-129, aa 149-192) (according to UniProt)
The protein
Effectors of protein activity
activity requires functional [[protein|MreB]] and [SW|MreBH] [Pubmed|23869552,16950129]
activity requires functional [[protein|MreB]] and [[protein|MreBH]] [Pubmed|23869552,16950129]
both enzymatic activities are inhibited by interaction with [[protein|IseA]] [pubmed|29458655]
The protein
[SW|Localization]
binds the cell wall [Pubmed|21261835]
localizes to cell septa, poles and lateral sidewall of the cell (via the N-terminal domain) [Pubmed|22139507]
localization to lateral cell wall depends on the interaction with [SW|MreBH] [Pubmed|23869552]
binds the cell wall [Pubmed|21261835]
localizes to cell septa, poles and lateral sidewall of the cell (via the N-terminal domain) [Pubmed|22139507]
localization to lateral cell wall depends on the interaction with [[protein|MreBH]] [Pubmed|23869552]
The protein
[SW|Interactions]
[SW|MreBH]-[[protein|LytE]] along the cylindrical part of the cell wall [Pubmed|16950129]
[[protein|FtsZ]]-[[protein|LytE]] at the division septum [Pubmed|16950129]
[[protein|PbpB]]-[[protein|LytE]] at the division septum [Pubmed|16950129]
Expression and Regulation
Operon
''lytE'' [Pubmed|9573210]
Expression and Regulation
[SW|Sigma factor]
[[protein|SigA]] [Pubmed|9573210], [[protein|SigH]] [Pubmed|9573210], [[protein|SigI]] [Pubmed|21541672]
Expression and Regulation
Regulation
repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
induced at high temperature ([[protein|SigI]], [[protein|WalR]]) [Pubmed|24125693,21541672]
Expression and Regulation
Regulatory mechanism
[[protein|WalR]]: transcription activation [Pubmed|24125693,17581128]
[SW|Spo0A]: transcription repression [Pubmed|14651647]
Biological materials
Mutant
1A790 ( ''lytE''::''cat''), [Pubmed|9457885], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A790&Search=1A790 BGSC]
1A792 ( ''lytE''::''cat''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]
1A1024 ( ''lytE''::''spec''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1024&Search=1A1024 BGSC]
BKE09420 (''[[protein|lytE]]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab)
1A790 ( ''lytE''::''cat''), [Pubmed|9457885], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A790&Search=1A790 BGSC]
1A792 ( ''lytE''::''cat''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]
1A1024 ( ''lytE''::''spec''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1024&Search=1A1024 BGSC]
BKE09420 ([[gene|lytE]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09420 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG
BKK09420 ([[gene|lytE]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG
References
Original publications
proteinLength
334
geneLength
1005
Gene
Coordinates
1,018,998 1,020,002
The protein
Structure
[PDB|4XCM] (from Thermus thermophilus, 34% identity) [pubmed|25760608]
Expression and Regulation
Operons
[[this]]
Expression and Regulation
Other regulations
[[this]]