Tue Dec 13 2016 11:16:30 GMT+0100 (CET)2025-05-12 05:39:06
description
DNA integrity scanning protein, diadenylate cyclase, delays sporulation in the case of chromosome damage, the DisA-dependent checkpoint arrests DNA replication during B. subtilis spore outgrowth until the germinating spores genome is free of damage
DNA integrity scanning protein, diadenylate cyclase, delays [SW|sporulation] in the case of chromosome damage, the DisA-dependent checkpoint arrests [SW|DNA replication] during B. subtilis spore outgrowth until the germinating spores genome is free of damage
locus
BSU00880
BSU_00880
function
control of sporulation initiation
control of [SW|sporulation] initiation
outlinks
bsu
BSU00880
BSU_00880
aminos
MEKEKKGAKHELDLSSILQFVAPGTPLRAGMENVLRANTGGLIVVGYNDKVKEVVDGGFHINTAFSPAHLYELAKMDGAIILSDSGQKILYANTQLMPDATISSSETGMRHRTAERVAKQTGCLVIAISERRNVITLYQENMKYTLKDIGFILTKANQAIQTLEKYKTILDKTINALNALEFEELVTFSDVLSVMHRYEMVLRIKNEINMYIKELGTEGHLIKLQVIELITDMEEEAALFIKDYVKEKIKDPFVLLKELQDMSSYDLLDDSIVYKLLGYPASTNLDDYVLPRGYRLLNKIPRLPMPIVENVVEAFGVLPRIIEASAEELDEVEGIGEVRAQKIKKGLKRLQEKHYLDRQL
[SW|Categories] containing this gene/protein
[SW|cell division], [SW|metabolism of signalling nucleotides], [SW|sporulation/ other], [SW|general stress proteins (controlled by SigB)], [SW|cell envelope stress proteins (controlled by SigM, V, W, X, Y)], [SW|heat shock proteins]
Gene
Coordinates on the chromosome (coding sequence)
107,476 -> 108,558
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352,21566650]
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352,21566650]
binds [[protein|RecA]] to inhibit its activity [pubmed|30916351]
2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)
The protein
Protein family
disA family (according to Swiss-Prot)
DisA family (single member, according to UniProt)
The protein
[SW|Domains]
contains a [SW|DAC domain] for the synthesis of c-di-AMP [Pubmed|18439896]
contains a [SW|DAC domain] for the synthesis of c-di-AMP [Pubmed|18439896]
[SW|DAC domain] (aa 11-149) (according to UniProt)
The protein
Effectors of protein activity
[[protein|RadA]] is an inhibitor of [[protein|DisA]] activity [Pubmed|23760274]
[[protein|RadA]] is an inhibitor of [[protein|DisA]] activity [Pubmed|23760274]
the presence of potassium results in enhanced activity [pubmed|28420751]
The protein
[SW|Localization]
see a [http://download.cell.com/mmcs/journals/0092-8674/PIIS0092867406005034.mmc12.avi video] showing the movement of DisA in the cell (in real time) [Pubmed|16713562]
forms discrete globular foci in germinating spres that colocalize with the nucleoid [Pubmed|24244006]
see a [http://download.cell.com/mmcs/journals/0092-8674/PIIS0092867406005034.mmc12.avi video] showing the movement of DisA in the cell (in real time) [Pubmed|16713562]
forms discrete globular foci in germinating spres that colocalize with the nucleoid [Pubmed|24244006]
forms rapidly moving focus that pauses at [[protein|RecA]]-mediated recombination intermediates upon induction of DNA damage during spore development [pubmed|30916351]
The protein
[SW|Interactions]
forms octamers
[[protein|RacA]]-[[protein|DisA]] [Pubmed|12493822]
[[protein|RadA]]-[[protein|DisA]] [Pubmed|23760274], this interaction result in the inhibition of [[protein|DisA]] activity [Pubmed|23760274]
Expression and Regulation
Operon
''[[protein|ctsR]]-[[protein|mcsA]]-[[protein|mcsB]]-[[protein|clpC]]-[[protein|radA]]-[[protein|disA]]'' [Pubmed|8793870]
''disA'' [Pubmed|17434969]
Expression and Regulation
[SW|Sigma factor]
''[[protein|ctsR]]'': [[protein|SigA]] [Pubmed|8793870], [[protein|SigB]] [http://www.ncbi.nlm.nih.gov/pubmed/8793870 PubMed1] [http://www.ncbi.nlm.nih.gov/pubmed/11544224 PubMed2]
''disA'': [[protein|SigM]] [Pubmed|17434969]
Expression and Regulation
Regulation
induced by stress ([[protein|SigB]]) [Pubmed|11544224], induced by heat ([[protein|CtsR]]) [Pubmed|9987115]
expressed during [SW|sporulation] in the mother cell [Pubmed|24244006]
expressed during germination and spore outgrowth [Pubmed|24244006]
Expression and Regulation
Regulatory mechanism
[[protein|CtsR]]: transcription repression [Pubmed|9987115]
Biological materials
Mutant
GP2142 (''[[protein|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab
BKG2 (''[[protein|radA]]-[[protein|disA]]::spc''), available in [SW|Jörg Stülke]'s lab
1A939 ( ''disA''::''tet''), [Pubmed|16713562], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A939&Search=1A939 BGSC]
MGNA-B932 ([[gene|disA]]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1931 NBRP B. subtilis, Japan]
GP2142 (''Δ''''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab
BKG2 (''[[gene|radA]]-[[gene|disA]]::spc''), available in [SW|Jörg Stülke]'s lab
1A939 ( ''disA''::''tet''), [Pubmed|16713562], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A939&Search=1A939 BGSC]
GP2222 ([[gene|cdaA]]::cat [[gene|cdaS]]::ermC [[gene|disA]]::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
BKE00880 ([[gene|disA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
BKK00880 ([[gene|disA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
GP2715 (''Δ''''[[gene|disA]]''::''spc''), available in [SW|Jörg Stülke]'s lab
GP2752 (''Δ''''[[gene|disA]]''::''cat''), available in [SW|Jörg Stülke]'s lab
GP2782 (''Δ''''[[gene|disA]]''::''kan''), available in [SW|Jörg Stülke]'s lab
Biological materials
Expression vector
IPTG inducible expression of His-''disA'' in ''E. coli'': pGP2563 (in [http://biochem.web.utah.edu/hill/links/pET19b.pdf pET19b]), available in [SW|Jörg Stülke]'s lab
References
Reviews
References
Original publications
proteinLength
360
geneLength
1083
Gene
Coordinates
107,476 108,558
Gene
Phenotypes of a mutant
a [[gene|cdaA]] [[gene|disA]] double mutant or [[gene|cdaA]] [[gene|cdaS]] [[gene|disA]] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
reduced spore survival after infrared exposure [pubmed|28961460]
altered morphology on MSgg medium [pubmed|29588402]
plant root colonization defect [pubmed|29588402]
The protein
Paralogous protein(s)
[[this]]
The protein
[SW|Cofactors]
Mn2+ [pubmed|26014055]
The protein
additional information
subject to Clp-dependent proteolysis upon glucose starvation [pubmed|17981983]
Expression and Regulation
Operons
[[this]]
Expression and Regulation
Other regulations
[[this]]
Biological materials
Expression vectors
IPTG inducible expression of His-''disA'' in ''E. coli'': pGP2563 (in [http://biochem.web.utah.edu/hill/links/pET19b.pdf pET19b]), available in [SW|Jörg Stülke]'s lab