SubtiBank SubtiBank
Version comparison:

2017-05-21 19:46:232025-05-24 14:34:45

description

DNA integrity scanning protein, diadenylate cyclase, delays sporulation in the case of chromosome damage, the DisA-dependent checkpoint arrests DNA replication during B. subtilis spore outgrowth until the germinating spores genome is free of damage

DNA integrity scanning protein, diadenylate cyclase, delays [SW|sporulation] in the case of chromosome damage, the DisA-dependent checkpoint arrests [SW|DNA replication] during B. subtilis spore outgrowth until the germinating spores genome is free of damage

locus

BSU00880

BSU_00880

geneLength

1080

1083

function

control of sporulation initiation

control of [SW|sporulation] initiation

outlinks

bsu

BSU00880

BSU_00880

Gene

Coordinates

107,476 → 108,558

107,476 108,558

The protein

Catalyzed reaction/ biological activity

synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352,21566650]

synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352,21566650]

binds [[protein|RecA]] to inhibit its activity [pubmed|30916351]

2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)

The protein

Protein family

disA family (according to Swiss-Prot)

DisA family (single member, according to UniProt)

The protein

[SW|Domains]

contains a [SW|DAC domain] for the synthesis of c-di-AMP [Pubmed|18439896]

contains a [SW|DAC domain] for the synthesis of c-di-AMP [Pubmed|18439896]

[SW|DAC domain] (aa 11-149) (according to UniProt)

The protein

[SW|Localization]

see a [http://download.cell.com/mmcs/journals/0092-8674/PIIS0092867406005034.mmc12.avi video] showing the movement of DisA in the cell (in real time) [Pubmed|16713562]

forms discrete globular foci in germinating spres that colocalize with the nucleoid [Pubmed|24244006]

see a [http://download.cell.com/mmcs/journals/0092-8674/PIIS0092867406005034.mmc12.avi video] showing the movement of DisA in the cell (in real time) [Pubmed|16713562]

forms discrete globular foci in germinating spres that colocalize with the nucleoid [Pubmed|24244006]

forms rapidly moving focus that pauses at [[protein|RecA]]-mediated recombination intermediates upon induction of DNA damage during spore development [pubmed|30916351]

Biological materials

Mutant

MGNA-B932 (yacK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1931 NBRP B. subtilis, Japan]

GP2142 (''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab

BKG2 (''[[gene|radA]]-[[gene|disA]]::spc''), available in [SW|Jörg Stülke]'s lab

1A939 ( ''disA''::''tet''), [Pubmed|16713562], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A939&Search=1A939 BGSC]

MGNA-B932 ([[gene|disA]]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1931 NBRP B. subtilis, Japan]

GP2142 (''Δ''''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab

BKG2 (''[[gene|radA]]-[[gene|disA]]::spc''), available in [SW|Jörg Stülke]'s lab

1A939 ( ''disA''::''tet''), [Pubmed|16713562], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A939&Search=1A939 BGSC]

GP2222 ([[gene|cdaA]]::cat [[gene|cdaS]]::ermC [[gene|disA]]::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]

BKE00880 ([[gene|disA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA

BKK00880 ([[gene|disA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA

GP2715 (''Δ''''[[gene|disA]]''::''spc''), available in [SW|Jörg Stülke]'s lab

GP2752 (''Δ''''[[gene|disA]]''::''cat''), available in [SW|Jörg Stülke]'s lab

GP2782 (''Δ''''[[gene|disA]]''::''kan''), available in [SW|Jörg Stülke]'s lab

Biological materials

Expression vector

IPTG inducible expression of His-''disA'' in ''E. coli'': pGP2563 (in [http://biochem.web.utah.edu/hill/links/pET19b.pdf pET19b]), available in [SW|Jörg Stülke]'s lab

References

Reviews

22933559, 18714086, 25869574, 23812326

22933559, 18714086, 25869574, 23812326, 30224435, 32472931, 32603625

References

Original publications

24244006, 8793870, 9987115, 16713562, 23760274, 11544224, 17434969, 18439896, 16713555, 12493822, 21566650, 23192352, 23608499, 25616256, 26014055, 27150552, 28420751, 28511132

24244006, 8793870, 9987115, 16713562, 23760274, 11544224, 17434969, 18439896, 16713555, 12493822, 21566650, 23192352, 23608499, 25616256, 26014055, 27150552, 28420751, 28511132, 28961460, 29536659, 29588402, 30877841, 30916351

Gene

Phenotypes of a mutant

a [[gene|cdaA]] [[gene|disA]] double mutant or [[gene|cdaA]] [[gene|cdaS]] [[gene|disA]] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]

reduced spore survival after infrared exposure [pubmed|28961460]

altered morphology on MSgg medium [pubmed|29588402]

plant root colonization defect [pubmed|29588402]

The protein

Paralogous protein(s)

[[this]]

The protein

[SW|Cofactors]

Mn2+ [pubmed|26014055]

Biological materials

Expression vectors

IPTG inducible expression of His-''disA'' in ''E. coli'': pGP2563 (in [http://biochem.web.utah.edu/hill/links/pET19b.pdf pET19b]), available in [SW|Jörg Stülke]'s lab