Wed Feb 08 2017 15:04:43 GMT+0100 (CET)2025-05-12 07:29:27
description
HPr, General component of the sugar phosphotransferase system (PTS)
HPr, General component of the sugar [SW|phosphotransferase system] (PTS)
locus
BSU13900
BSU_13900
names
ptsH
hpr
ptsH
HPr
outlinks
bsu
BSU13900
BSU_13900
[SW|Categories] containing this gene/protein
[SW|phosphotransferase systems], [SW|transcription factors and their control], [SW|phosphoproteins], [SW|most abundant proteins]
Gene
Coordinates on the chromosome (coding sequence)
1,459,384 -> 1,459,650
The protein
Catalyzed reaction/ biological activity
Protein HPr N(pi)-phospho-L-histidine protein EIIA = protein HPr protein EIIA N(tau)-phospho-L-histidine (according to Swiss-Prot) Protein HPr N(pi)-phospho-L-histidine protein EIIA = protein [[PtsH|HPr]] protein EIIA N(tau)-phospho-L-histidine
The protein
Protein family
HPr domain (according to Swiss-Prot) HPr family
HPr family (with [[protein|Crh]], according to UniProt)
The protein
Paralogous protein(s)
[[protein|Crh]]
[[this]]
The protein
[SW|Domains]
HPr Domain (2–88)
HPr domain (aa 2-88) (according to UniProt)
The protein
Modification
transient phosphorylation by [[PtsI |Enzyme I]] of the PTS on His-15
regulatory phosphorylation on Ser-46 by [[protein|HprK]] [Pubmed|2507315]
an extensive study on ''in vivo'' HPr phosphorylation can be found in Singh et al. (2008) [http://www.ncbi.nlm.nih.gov/sites/entrez/18757537 PubMed]
weak phosphorylation on Ser-12 [Pubmed|17218307]
''in vitro'' phosphorylated by [[protein|PrkC]] on Ser-12 [Pubmed|20389117]
transient phosphorylation by [[protein|PtsI|Enzyme I]] of the PTS on His-15
regulatory phosphorylation on Ser-46 by [[protein|HprK]] [Pubmed|2507315]
an extensive study on ''in vivo'' HPr phosphorylation can be found in Singh et al. (2008) [PubMed|18757537]
weak phosphorylation on Ser-12 [Pubmed|17218307]
''in vitro'' phosphorylated by [[protein|PrkC]] on Ser-12 [Pubmed|20389117]
The protein
Structure
[PDB|2HID] (NMR) [Pubmed|9336834]
[PDB|1KKM] (complex of ''L. casei'' [[protein|HprK]] with ''B. subtilis'' HPr-Ser-P)
[PDB|1KKL] (complex of ''Lactobacillus casei'' [[protein|HprK]] with ''B. subtilis'' HPr)
[PDB|3OQM] (complex of ''B. subtilis'' CcpA with P-Ser-[[PtsH|HPr]] and the ''[[protein|ackA]]'' operator site)
[PDB|3OQN] (complex of ''B. subtilis'' CcpA with P-Ser-[[PtsH|HPr]] and the ''[[protein|gntR]]'' operator site)
[PDB|3OQO] (complex of ''B. subtilis'' CcpA with P-Ser-[[PtsH|HPr]] and a optimal synthetic operator site)
[PDB|2HID] (NMR) [Pubmed|9336834]
[PDB|1KKM] (complex of ''L. casei'' [[protein|HprK]] with ''B. subtilis'' HPr-Ser-P)
[PDB|1KKL] (complex of ''Lactobacillus casei'' [[protein|HprK]] with ''B. subtilis'' HPr)
[PDB|3OQM] (complex of ''B. subtilis'' [[protein|CcpA]] with P-Ser-[[protein|PtsH|HPr]] and the [[gene|ackA]] operator site)
[PDB|3OQN] (complex of ''B. subtilis'' [[protein|CcpA]] with P-Ser-[[protein|PtsH|HPr]] and the [[gene|gntR]] operator site)
[PDB|3OQO] (complex of ''B. subtilis'' [[protein|CcpA]] with P-Ser-[[protein|PtsH|HPr]] and a optimal synthetic operator site)
The protein
[SW|Localization]
cytoplasm [Pubmed|16395550]
cytoplasm [Pubmed|23475962]
The protein
[SW|Interactions]
[[protein|HprK]]-[[PtsH|HPr]] [Pubmed|12009882]
[[PtsI|Enzyme I]]-[[PtsH|HPr]]
[[PtsH|HPr]]-[[protein|PtsG]] [Pubmed|8418852], [[protein|PtsH]]-[[protein|MtlF]] [Pubmed|20444094], [[protein|ManP]]-[[PtsH|HPr]], [[protein|GmuA]]-[[PtsH|HPr]]
[[protein|GamP]]-[[PtsH|HPr]], [[protein|BglP]]-[[PtsH|HPr]], [[protein|LicA]]-[[PtsH|HPr]], [[protein|LevD]]-[[PtsH|HPr]]
[[protein|FruA]]-[[PtsH|HPr]], [[protein|YpqE]]-[[PtsH|HPr]]
[[PtsH|HPr]]-[[protein|LicT]], [[PtsH|HPr]]-[[protein|SacY]], [[PtsH|HPr]]-[[protein|SacT]], [[PtsH|HPr]]-[[protein|GlcT]]
[[PtsH|HPr]]-[[protein|MtlR]] [Pubmed|20444094], [[PtsH|HPr]]-[[protein|LicR]], [[PtsH|HPr]]-[[protein|LevR]],[[PtsH|HPr]]-[[protein|ManR]]
[[PtsH|HPr]]-[[protein|GlpK]]
[[protein|GapA]]-[[PtsH|HPr]] [Pubmed|17142398]
[[PtsH|HPr(Ser-46)-P]]-[[protein|CcpA]] [Pubmed|12432959]
[[PtsH|HPr]]-[[protein|RbsR]] [Pubmed|16519689]
[[PtsH|HPr(His)-P]]-[[protein|RhgR]] [Pubmed|19651770]
Expression and Regulation
Operon
''[[protein|ptsG]]-[[protein|ptsH]]-[[protein|ptsI]]'' [Pubmed|11902727]
''[[protein|ptsH]]-[[protein|ptsI]]'' [Pubmed|11902727]
Expression and Regulation
[SW|Sigma factor]
''[[protein|ptsG]]'': [[protein|SigA]] [Pubmed|11902727]
''[[protein|ptsH]]'': [[protein|SigA]] [Pubmed|11902727]
Expression and Regulation
Regulation
expression activated by glucose (2 fold) ([[protein|GlcT]]) [Pubmed|12850135]
the ''[[protein|ptsH]]'' promoter is constitutive [Pubmed|11902727]
subject to negative stringent control upon amino acid limitation (due to control of'' [[protein|ptsG]]'' transcription initiation) [Pubmed|20081037]
Expression and Regulation
Regulatory mechanism
''[[protein|ptsG]]'': transcriptional antitermination via the [[protein|GlcT]]-dependent [SW|RNA switch] [Pubmed|9765562]
Expression and Regulation
Additional information
belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
Biological materials
Mutant
available in [SW|Jörg Stülke]'s lab:
MZ303 (cat)
GP507 ptsH1 (S46A)
GP506 (ptsH-H15A)
GP778 (replacement of ''[[protein|glcT]]'' and the ''[[protein|ptsG]]-[[protein|ptsH]]-[[protein|ptsI]]'' operon by a spc cassette), [Pubmed|22722928]
available in [SW|Jörg Stülke]'s lab:
MZ303 (cat)
GP507 [[gene|ptsH]]1 (S46A)
GP506 ([[gene|ptsH]]-H15A)
GP778 (Δ[[gene|glcT]]-[[gene|ptsG]]-[[gene|ptsH]]-[[gene|ptsI]]::spc) [Pubmed|22722928]
BKE13900 (Δ[[gene|ptsH]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
BKK13900 (Δ[[gene|ptsH]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
Biological materials
Expression vector
pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab
pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
Labs working on this gene/protein
[SW|Josef Deutscher], Paris-Grignon, France
[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
[SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
[SW|Boris Görke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/goerke.html Homepage]
[SW|Anne Galinier], University of Marseille, France
References
proteinLength
88
geneLength
267
Gene
Coordinates
1,459,384 1,459,650
The protein
additional information
belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
Expression and Regulation
Operons
[[this]]
Expression and Regulation
Other regulations
[[this]]
Biological materials
GFP fusion
GP1267, [[gene|ptsH]]-cfp, available in [SW|Jörg Stülke]'s lab [pubmed|23475962]
Biological materials
Expression vectors
pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab
pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
labs
[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
[SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
[SW|Boris Görke], Max Perutz Center, Vienna, Austria
[SW|Anne Galinier], University of Marseille, France