SubtiBank SubtiBank
Version comparison:

Wed Feb 08 2017 15:04:43 GMT+0100 (CET)2025-05-12 07:29:27

description

HPr, General component of the sugar phosphotransferase system (PTS)

HPr, General component of the sugar [SW|phosphotransferase system] (PTS)

locus

BSU13900

BSU_13900

names

ptsH

hpr

ptsH

HPr

outlinks

bsu

BSU13900

BSU_13900

[SW|Categories] containing this gene/protein

[SW|phosphotransferase systems], [SW|transcription factors and their control], [SW|phosphoproteins], [SW|most abundant proteins]

Gene

Coordinates on the chromosome (coding sequence)

1,459,384 -> 1,459,650

The protein

Catalyzed reaction/ biological activity

Protein HPr N(pi)-phospho-L-histidine protein EIIA = protein HPr protein EIIA N(tau)-phospho-L-histidine (according to Swiss-Prot) Protein HPr N(pi)-phospho-L-histidine protein EIIA = protein [[PtsH|HPr]] protein EIIA N(tau)-phospho-L-histidine

The protein

Protein family

HPr domain (according to Swiss-Prot) HPr family

HPr family (with [[protein|Crh]], according to UniProt)

The protein

Paralogous protein(s)

[[protein|Crh]]

[[this]]

The protein

[SW|Domains]

HPr Domain (2–88)

HPr domain (aa 2-88) (according to UniProt)

The protein

Modification

transient phosphorylation by [[PtsI |Enzyme I]] of the PTS on His-15

regulatory phosphorylation on Ser-46 by [[protein|HprK]] [Pubmed|2507315]

an extensive study on ''in vivo'' HPr phosphorylation can be found in Singh et al. (2008) [http://www.ncbi.nlm.nih.gov/sites/entrez/18757537 PubMed]

weak phosphorylation on Ser-12 [Pubmed|17218307]

''in vitro'' phosphorylated by [[protein|PrkC]] on Ser-12 [Pubmed|20389117]

transient phosphorylation by [[protein|PtsI|Enzyme I]] of the PTS on His-15

regulatory phosphorylation on Ser-46 by [[protein|HprK]] [Pubmed|2507315]

an extensive study on ''in vivo'' HPr phosphorylation can be found in Singh et al. (2008) [PubMed|18757537]

weak phosphorylation on Ser-12 [Pubmed|17218307]

''in vitro'' phosphorylated by [[protein|PrkC]] on Ser-12 [Pubmed|20389117]

The protein

Structure

[PDB|2HID] (NMR) [Pubmed|9336834]

[PDB|1KKM] (complex of ''L. casei'' [[protein|HprK]] with ''B. subtilis'' HPr-Ser-P)

[PDB|1KKL] (complex of ''Lactobacillus casei'' [[protein|HprK]] with ''B. subtilis'' HPr)

[PDB|3OQM] (complex of ''B. subtilis'' CcpA with P-Ser-[[PtsH|HPr]] and the ''[[protein|ackA]]'' operator site)

[PDB|3OQN] (complex of ''B. subtilis'' CcpA with P-Ser-[[PtsH|HPr]] and the ''[[protein|gntR]]'' operator site)

[PDB|3OQO] (complex of ''B. subtilis'' CcpA with P-Ser-[[PtsH|HPr]] and a optimal synthetic operator site)

[PDB|2HID] (NMR) [Pubmed|9336834]

[PDB|1KKM] (complex of ''L. casei'' [[protein|HprK]] with ''B. subtilis'' HPr-Ser-P)

[PDB|1KKL] (complex of ''Lactobacillus casei'' [[protein|HprK]] with ''B. subtilis'' HPr)

[PDB|3OQM] (complex of ''B. subtilis'' [[protein|CcpA]] with P-Ser-[[protein|PtsH|HPr]] and the [[gene|ackA]] operator site)

[PDB|3OQN] (complex of ''B. subtilis'' [[protein|CcpA]] with P-Ser-[[protein|PtsH|HPr]] and the [[gene|gntR]] operator site)

[PDB|3OQO] (complex of ''B. subtilis'' [[protein|CcpA]] with P-Ser-[[protein|PtsH|HPr]] and a optimal synthetic operator site)

The protein

[SW|Localization]

cytoplasm [Pubmed|16395550]

cytoplasm [Pubmed|23475962]

The protein

[SW|Interactions]

[[protein|HprK]]-[[PtsH|HPr]] [Pubmed|12009882]

[[PtsI|Enzyme I]]-[[PtsH|HPr]]

[[PtsH|HPr]]-[[protein|PtsG]] [Pubmed|8418852], [[protein|PtsH]]-[[protein|MtlF]] [Pubmed|20444094], [[protein|ManP]]-[[PtsH|HPr]], [[protein|GmuA]]-[[PtsH|HPr]]

[[protein|GamP]]-[[PtsH|HPr]], [[protein|BglP]]-[[PtsH|HPr]], [[protein|LicA]]-[[PtsH|HPr]], [[protein|LevD]]-[[PtsH|HPr]]

[[protein|FruA]]-[[PtsH|HPr]], [[protein|YpqE]]-[[PtsH|HPr]]

[[PtsH|HPr]]-[[protein|LicT]], [[PtsH|HPr]]-[[protein|SacY]], [[PtsH|HPr]]-[[protein|SacT]], [[PtsH|HPr]]-[[protein|GlcT]]

[[PtsH|HPr]]-[[protein|MtlR]] [Pubmed|20444094], [[PtsH|HPr]]-[[protein|LicR]], [[PtsH|HPr]]-[[protein|LevR]],[[PtsH|HPr]]-[[protein|ManR]]

[[PtsH|HPr]]-[[protein|GlpK]]

[[protein|GapA]]-[[PtsH|HPr]] [Pubmed|17142398]

[[PtsH|HPr(Ser-46)-P]]-[[protein|CcpA]] [Pubmed|12432959]

[[PtsH|HPr]]-[[protein|RbsR]] [Pubmed|16519689]

[[PtsH|HPr(His)-P]]-[[protein|RhgR]] [Pubmed|19651770]

Expression and Regulation

Operon

''[[protein|ptsG]]-[[protein|ptsH]]-[[protein|ptsI]]'' [Pubmed|11902727]

''[[protein|ptsH]]-[[protein|ptsI]]'' [Pubmed|11902727]

Expression and Regulation

[SW|Sigma factor]

''[[protein|ptsG]]'': [[protein|SigA]] [Pubmed|11902727]

''[[protein|ptsH]]'': [[protein|SigA]] [Pubmed|11902727]

Expression and Regulation

Regulation

expression activated by glucose (2 fold) ([[protein|GlcT]]) [Pubmed|12850135]

the ''[[protein|ptsH]]'' promoter is constitutive [Pubmed|11902727]

subject to negative stringent control upon amino acid limitation (due to control of'' [[protein|ptsG]]'' transcription initiation) [Pubmed|20081037]

Expression and Regulation

Regulatory mechanism

''[[protein|ptsG]]'': transcriptional antitermination via the [[protein|GlcT]]-dependent [SW|RNA switch] [Pubmed|9765562]

Expression and Regulation

Additional information

belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]

Biological materials

Mutant

available in [SW|Jörg Stülke]'s lab:

MZ303 (cat)

GP507 ptsH1 (S46A)

GP506 (ptsH-H15A)

GP778 (replacement of ''[[protein|glcT]]'' and the ''[[protein|ptsG]]-[[protein|ptsH]]-[[protein|ptsI]]'' operon by a spc cassette), [Pubmed|22722928]

available in [SW|Jörg Stülke]'s lab:

MZ303 (cat)

GP507 [[gene|ptsH]]1 (S46A)

GP506 ([[gene|ptsH]]-H15A)

GP778 (Δ[[gene|glcT]]-[[gene|ptsG]]-[[gene|ptsH]]-[[gene|ptsI]]::spc) [Pubmed|22722928]

BKE13900 (Δ[[gene|ptsH]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

BKK13900 (Δ[[gene|ptsH]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

Biological materials

Expression vector

pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab

pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab

pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

Labs working on this gene/protein

[SW|Josef Deutscher], Paris-Grignon, France

[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

[SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]

[SW|Boris Görke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/goerke.html Homepage]

[SW|Anne Galinier], University of Marseille, France

References

16519689, 12850135, 17218307, 16519689, 17142398, 12359875, 1577686, 9162046, 11929549, 9336834, 7803390, 7623661, 2846556, 8169206, 9973552, 15126459, 10048041, 12169607, 9622354, 10217795, 17693724, 18757537, 9202047, 7592487, 15369672, 14527945, 2507315, 8580838, 19651770, 8418852, 26282429, 1303754, 1549615, 20081037, 20389117, 20444094, 22001508, 22722928, 23551403, 15378759, 26381121, 9336834

16519689, 12850135, 17218307, 16519689, 17142398, 12359875, 1577686, 9162046, 11929549, 9336834, 7803390, 7623661, 2846556, 8169206, 9973552, 15126459, 10048041, 12169607, 9622354, 10217795, 17693724, 18757537, 9202047, 7592487, 15369672, 14527945, 2507315, 8580838, 19651770, 8418852, 26282429, 1303754, 1549615, 20081037, 20389117, 20444094, 22001508, 22722928, 23551403, 15378759, 26381121, 9336834, 23475962

proteinLength

88

geneLength

267

Gene

Coordinates

1,459,384 1,459,650

The protein

additional information

belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]

Expression and Regulation

Operons

[[this]]

Expression and Regulation

Other regulations

[[this]]

Biological materials

GFP fusion

GP1267, [[gene|ptsH]]-cfp, available in [SW|Jörg Stülke]'s lab [pubmed|23475962]

Biological materials

Expression vectors

pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab

pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab

pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

labs

[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

[SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]

[SW|Boris Görke], Max Perutz Center, Vienna, Austria

[SW|Anne Galinier], University of Marseille, France