SubtiBank SubtiBank
Version comparison:

2017-06-23 17:34:142025-05-14 21:31:58

description

HPr, General component of the sugar [SW|Phosphotransferase system] (PTS)

HPr, General component of the sugar [SW|phosphotransferase system] (PTS)

locus

BSU13900

BSU_13900

geneLength

264

267

outlinks

bsu

BSU13900

BSU_13900

Gene

Coordinates

1,459,384 → 1,459,650

1,459,384 1,459,650

The protein

Catalyzed reaction/ biological activity

Protein HPr N(pi)-phospho-L-histidine + protein EIIA = protein HPr + protein EIIA N(tau)-phospho-L-histidine (according to Swiss-Prot)

The protein

Protein family

HPr domain (according to Swiss-Prot) HPr family

HPr family (with [[protein|Crh]], according to UniProt)

The protein

Paralogous protein(s)

[[protein|Crh]]

[[this]]

The protein

[SW|Domains]

HPr Domain (2–88)

HPr domain (aa 2-88) (according to UniProt)

The protein

[SW|Localization]

cytoplasm [Pubmed|16395550]

cytoplasm [Pubmed|23475962]

Biological materials

Mutant

available in [SW|Jörg Stülke]'s lab:

MZ303 (cat)

GP507 ptsH1 (S46A)

GP506 (ptsH-H15A)

GP778 (Δ[[gene|glcT]]-[[gene|ptsG]]-[[gene|ptsH]]-[[gene|ptsI]]::spc) [Pubmed|22722928]

available in [SW|Jörg Stülke]'s lab:

MZ303 (cat)

GP507 [[gene|ptsH]]1 (S46A)

GP506 ([[gene|ptsH]]-H15A)

GP778 (Δ[[gene|glcT]]-[[gene|ptsG]]-[[gene|ptsH]]-[[gene|ptsI]]::spc) [Pubmed|22722928]

BKE13900 (Δ[[gene|ptsH]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

BKK13900 (Δ[[gene|ptsH]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

Biological materials

Expression vector

pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab

pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab

pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

Labs working on this gene/protein

[SW|Josef Deutscher], Paris-Grignon, France

[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

[SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]

[SW|Boris Görke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/goerke.html Homepage]

[SW|Anne Galinier], University of Marseille, France

References

16519689, 12850135, 17218307, 16519689, 17142398, 12359875, 1577686, 9162046, 11929549, 9336834, 7803390, 7623661, 2846556, 8169206, 9973552, 15126459, 10048041, 12169607, 9622354, 10217795, 17693724, 18757537, 9202047, 7592487, 15369672, 14527945, 2507315, 8580838, 19651770, 8418852, 26282429, 1303754, 1549615, 20081037, 20389117, 20444094, 22001508, 22722928, 23551403, 15378759, 26381121, 9336834

16519689, 12850135, 17218307, 16519689, 17142398, 12359875, 1577686, 9162046, 11929549, 9336834, 7803390, 7623661, 2846556, 8169206, 9973552, 15126459, 10048041, 12169607, 9622354, 10217795, 17693724, 18757537, 9202047, 7592487, 15369672, 14527945, 2507315, 8580838, 19651770, 8418852, 26282429, 1303754, 1549615, 20081037, 20389117, 20444094, 22001508, 22722928, 23551403, 15378759, 26381121, 9336834, 23475962

Biological materials

GFP fusion

GP1267, [[gene|ptsH]]-cfp, available in [SW|Jörg Stülke]'s lab [pubmed|23475962]

Biological materials

Expression vectors

pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab

pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab

pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

labs

[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

[SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]

[SW|Boris Görke], Max Perutz Center, Vienna, Austria

[SW|Anne Galinier], University of Marseille, France