2017-06-23 17:34:142025-05-14 21:31:58
description
HPr, General component of the sugar [SW|Phosphotransferase system] (PTS)
HPr, General component of the sugar [SW|phosphotransferase system] (PTS)
locus
BSU13900
BSU_13900
geneLength
264
267
outlinks
bsu
BSU13900
BSU_13900
Gene
Coordinates
1,459,384 → 1,459,650
1,459,384 1,459,650
The protein
Catalyzed reaction/ biological activity
Protein HPr N(pi)-phospho-L-histidine + protein EIIA = protein HPr + protein EIIA N(tau)-phospho-L-histidine (according to Swiss-Prot)
The protein
Protein family
HPr domain (according to Swiss-Prot) HPr family
HPr family (with [[protein|Crh]], according to UniProt)
The protein
Paralogous protein(s)
[[protein|Crh]]
[[this]]
The protein
[SW|Domains]
HPr Domain (2–88)
HPr domain (aa 2-88) (according to UniProt)
The protein
[SW|Localization]
cytoplasm [Pubmed|16395550]
cytoplasm [Pubmed|23475962]
Biological materials
Mutant
available in [SW|Jörg Stülke]'s lab:
MZ303 (cat)
GP507 ptsH1 (S46A)
GP506 (ptsH-H15A)
GP778 (Δ[[gene|glcT]]-[[gene|ptsG]]-[[gene|ptsH]]-[[gene|ptsI]]::spc) [Pubmed|22722928]
available in [SW|Jörg Stülke]'s lab:
MZ303 (cat)
GP507 [[gene|ptsH]]1 (S46A)
GP506 ([[gene|ptsH]]-H15A)
GP778 (Δ[[gene|glcT]]-[[gene|ptsG]]-[[gene|ptsH]]-[[gene|ptsI]]::spc) [Pubmed|22722928]
BKE13900 (Δ[[gene|ptsH]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
BKK13900 (Δ[[gene|ptsH]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
Biological materials
Expression vector
pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab
pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
Labs working on this gene/protein
[SW|Josef Deutscher], Paris-Grignon, France
[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
[SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
[SW|Boris Görke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/goerke.html Homepage]
[SW|Anne Galinier], University of Marseille, France
References
Biological materials
GFP fusion
GP1267, [[gene|ptsH]]-cfp, available in [SW|Jörg Stülke]'s lab [pubmed|23475962]
Biological materials
Expression vectors
pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab
pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
labs
[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
[SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
[SW|Boris Görke], Max Perutz Center, Vienna, Austria
[SW|Anne Galinier], University of Marseille, France