SubtiBank SubtiBank
Version comparison:

2019-07-30 08:49:332025-01-21 10:23:08

Gene

Phenotypes of a mutant

a [[gene|recD2]] [[gene|recG]] double mutant is not viable [pubmed|28527403]

a [[gene|recD2]] [[gene|recG]] double mutant is not viable [pubmed|28527403]

a [[gene|recG]] [[gene|radA]] double mutant is non-transformable with chromosomal DNA [pubmed|31350886]

The protein

Catalyzed reaction/ biological activity

binds and unwinds Holliday junction DNA [Pubmed|24770420]

binds and unwinds Holliday junction DNA [Pubmed|24770420]

ATP + H2O --> ADP + H+ + phosphate (according to UniProt)

Biological materials

Mutant

1A897 (no resistance), [Pubmed|16020779], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A897&Search=1A897 BGSC]

BKE15870 ([[gene|recG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG

BKK15870 ([[gene|recG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG

1A897 (no resistance), [Pubmed|16020779], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A897&Search=1A897 BGSC]

BKE15870 ([[gene|recG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG

BKK15870 ([[gene|recG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15870 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG

References

17853894, 15533834, 17640277, 24770420, 21170359, 28527403

17853894, 15533834, 17640277, 24770420, 21170359, 28527403, 31350886, 17853894

The protein

[SW|Domains]

[SW|Helicase ATP-binding domain] (aa 271-432) (according to UniProt)

[SW|Helicase C-terminal domain] (aa 451-611) (according to UniProt)

The protein

[SW|Localization]

associated with the [SW|replisome] [pubmed|17853894]