2019-04-17 09:21:422025-05-26 02:39:56
locus
BSU13400
BSU_13400
outlinks
bsu
BSU13400
BSU_13400
Gene
Phenotypes of a mutant
sensitivity to ionizing radiation in the stationary phase [Pubmed|12215643]
sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat [Pubmed|16497325,17293412]
a ''[[gene|ykoV]]-[[gene|ligD]]'' double mutant is sensitive to radiation [Pubmed|24123749]
sensitivity to ionizing radiation in the stationary phase [Pubmed|12215643]
sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat [Pubmed|16497325,17293412]
a ''[[gene|ykoV]]-[[gene|ligD]]'' double mutant is sensitive to radiation [Pubmed|24123749]
reduced resistance towards electron beams [pubmed|31948638]
The protein
Catalyzed reaction/ biological activity
has inherent polymerization and ligase activities that allow it to fill the short gaps that can arise after realignment of the broken ends and to seal the resulting nicks, contributing to genome stability during the stationary phase and germination
has an intrinsic 5'-2-deoxyribose-5-phosphate (dRP) lyase activity located at the N-terminal ligase domain [Pubmed|26826709]
has inherent polymerization and ligase activities that allow it to fill the short gaps that can arise after realignment of the broken ends and to seal the resulting nicks, contributing to genome stability during the stationary phase and germination
has an intrinsic 5'-2-deoxyribose-5-phosphate (dRP) lyase activity located at the N-terminal ligase domain [Pubmed|26826709]
ATP + (deoxyribonucleotide)(n)-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)(m) --> (deoxyribonucleotide)(n+m) + AMP + diphosphate (according to UniProt)
The protein
Structure
[PDB|6NHX] (N-terminal ligase domain, 26.3% identity)
[PDB|5OP0] (C-terminal polymerase domain, from Mycobacterium smegmatis, 30% identity)
[PDB|6NHX] (N-terminal ligase domain, from Mycobacterium tuberculosis, 26.3% identity) [pubmed|30718283]
[PDB|5OP0] (C-terminal polymerase domain, from Mycobacterium smegmatis, 30% identity) [pubmed|29089537]
Biological materials
Mutant
MGNA-A778 (ykoU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/778 NBRP B. subtilis, Japan]
BP141 (''[[gene|ykoV]]-[[gene|ligD]]''::''kan'') available in [SW|Fabian Commichau]'s lab
BP142 (''[[gene|dgcW]]-[[gene|ykoV]]-[[gene|ligD]]''::''kan'') available in [SW|Fabian Commichau]'s lab
BKE13400 ([[gene|ligD]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT
BKK13400 ([[gene|ligD]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT
MGNA-A778 (ykoU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/778 NBRP B. subtilis, Japan]
BP141 (Δ''[[gene|ykoV]]-[[gene|ligD]]''::''kan'') available in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs [pubmed|30863384]
BP142 (Δ''[[gene|dgcW]]-[[gene|ykoV]]-[[gene|ligD]]''::''kan'') available in [SW|Fabian Commichau]'s lab
BKE13400 (Δ[[gene|ligD]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT
BKK13400 (Δ[[gene|ligD]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT
References
Original publications
The protein
Protein family
N-terminal part: LigD polymerase family (single member, according to UniProt)
C-terminal part: ATP-dependent DNA ligase family (with [[protein|LigB]], according to UniProt)