SubtiBank SubtiBank
Version comparison:

2019-04-17 09:21:422025-05-26 02:39:56

locus

BSU13400

BSU_13400

outlinks

bsu

BSU13400

BSU_13400

Gene

Phenotypes of a mutant

sensitivity to ionizing radiation in the stationary phase [Pubmed|12215643]

sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat [Pubmed|16497325,17293412]

a ''[[gene|ykoV]]-[[gene|ligD]]'' double mutant is sensitive to radiation [Pubmed|24123749]

sensitivity to ionizing radiation in the stationary phase [Pubmed|12215643]

sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat [Pubmed|16497325,17293412]

a ''[[gene|ykoV]]-[[gene|ligD]]'' double mutant is sensitive to radiation [Pubmed|24123749]

reduced resistance towards electron beams [pubmed|31948638]

The protein

Catalyzed reaction/ biological activity

has inherent polymerization and ligase activities that allow it to fill the short gaps that can arise after realignment of the broken ends and to seal the resulting nicks, contributing to genome stability during the stationary phase and germination

has an intrinsic 5'-2-deoxyribose-5-phosphate (dRP) lyase activity located at the N-terminal ligase domain [Pubmed|26826709]

has inherent polymerization and ligase activities that allow it to fill the short gaps that can arise after realignment of the broken ends and to seal the resulting nicks, contributing to genome stability during the stationary phase and germination

has an intrinsic 5'-2-deoxyribose-5-phosphate (dRP) lyase activity located at the N-terminal ligase domain [Pubmed|26826709]

ATP + (deoxyribonucleotide)(n)-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)(m) --> (deoxyribonucleotide)(n+m) + AMP + diphosphate (according to UniProt)

The protein

Structure

[PDB|6NHX] (N-terminal ligase domain, 26.3% identity)

[PDB|5OP0] (C-terminal polymerase domain, from Mycobacterium smegmatis, 30% identity)

[PDB|6NHX] (N-terminal ligase domain, from Mycobacterium tuberculosis, 26.3% identity) [pubmed|30718283]

[PDB|5OP0] (C-terminal polymerase domain, from Mycobacterium smegmatis, 30% identity) [pubmed|29089537]

Biological materials

Mutant

MGNA-A778 (ykoU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/778 NBRP B. subtilis, Japan]

BP141 (''[[gene|ykoV]]-[[gene|ligD]]''::''kan'') available in [SW|Fabian Commichau]'s lab

BP142 (''[[gene|dgcW]]-[[gene|ykoV]]-[[gene|ligD]]''::''kan'') available in [SW|Fabian Commichau]'s lab

BKE13400 ([[gene|ligD]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT

BKK13400 ([[gene|ligD]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT

MGNA-A778 (ykoU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/778 NBRP B. subtilis, Japan]

BP141 (Δ''[[gene|ykoV]]-[[gene|ligD]]''::''kan'') available in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs [pubmed|30863384]

BP142 (Δ''[[gene|dgcW]]-[[gene|ykoV]]-[[gene|ligD]]''::''kan'') available in [SW|Fabian Commichau]'s lab

BKE13400 (Δ[[gene|ligD]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT

BKK13400 (Δ[[gene|ligD]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT

References

Original publications

16497325, 23691176, 12215643, 11075926, 11566200, 17293412, 24123749, 24123749, 25355514, 26826709, 26961308, 15778718, 16518468, 29234047, 30746801, 30976810

16497325, 23691176, 12215643, 11075926, 11566200, 17293412, 24123749, 24123749, 25355514, 26826709, 26961308, 15778718, 16518468, 29234047, 30746801, 30976810, 30718283, 29089537, 31948638

The protein

Protein family

N-terminal part: LigD polymerase family (single member, according to UniProt)

C-terminal part: ATP-dependent DNA ligase family (with [[protein|LigB]], according to UniProt)