SubtiBank SubtiBank
Version comparison:

2017-10-05 09:05:362017-8-11 16:0:3

Biological materials

Mutant

MGNA-A258 (ygaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/258 NBRP B. subtilis, Japan]

HB0509 (spc), available in [SW|John Helmann]'s and [SW|Jörg Stülke]'s labs, also GP868 (''fur::mls'', ''perR::spc'').

1A903 ( ''perR''::''kan''), [Pubmed|12029044], available at the [http://bgsc.org/getdetail.php?bgscid=1A903 Bacillus Genetic Stock Center]

BKE08730 (Δ[[gene|perR]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCATGCACCTCTCT, downstream forward: _UP4_TAAAAATAAGCTGACCGCAC

BKK08730 (Δ[[gene|perR]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCATGCACCTCTCT, downstream forward: _UP4_TAAAAATAAGCTGACCGCAC

MGNA-A258 (ygaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/258 NBRP B. subtilis, Japan]

HB0509 (spc), available in [SW|John Helmann]'s and [SW|Jörg Stülke]'s labs, also GP868 (''fur::mls'', ''perR::spc'').

1A903 ( ''perR''::''kan''), [Pubmed|12029044], available at the [http://bgsc.org/getdetail.php?bgscid=1A903 Bacillus Genetic Stock Center]

BKE08730 (''perR''::''erm trpC2'') is available at the [http://bgsc.org/ Bacillus Genetic Stock Center] [pubmed|28189581]

_ec