You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
dprA
conveys incoming ssDNA to
RecA; facilitates the displacement of both SSBs (
SsbB and
SsbA), increases
RecA nucleation onto SSB-coated ssDNA, and mediates DNA strand annealing, required to internalize and to recombine ssDNA with homologous resident duplex
Molecular weight
32.78 kDa
Product
recombination mediator protein
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,682,580 → 1,683,473
Phenotypes of a mutant
strongly impaired genetic recombination PubMedrecO dprA double mutants have a strongly reduced chromosomal transformation rate PubMedloss of plasmid transformation PubMed The protein
Catalyzed reaction/ biological activity
binds ssDNA, promotes displacement of SsbA and SsbB from ssDNA PubMedprovides RecA access to ssDNA during chromosomal transformation (together with RecO) PubMedRecA-ATP in concert with DprA and SsbA catalyzes DNA strand exchange, with SsbB as an accessory factor PubMedthe SsbA-DprA mediator loads RecA onto any fragmented linear SPP1 ssDNA PubMedanneals SsbA- or SsbB-coated complementary strands of transfecting SPP1 phage DNA, yielding tailed SPP1 duplex intermediates PubMedDprA, RecO or viral single strand annealing G35P protein, may catalyze the annealing of complete linear phage genomes with redundant regions at the ends of the molecule, alone or with the help of an exonuclease, to produce a circular unit-length duplex viral genome ready to initiate replication PubMed Protein family
DprA/Smf family (single member, according to UniProt)Structure
3UQZ (aa 90 ... 310, from Streptococcus pneumoniae, 44% identity) PubMed Localization
transiently localizes to the cell pole, and co-localizes with the DNA uptake machinery PubMed Expression and Regulation
Operons
Additional information
expressed under conditions that trigger genetic competence (ComK) PubMed Biological materials
Mutant
BKE16110 (ΔdprA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAACBKK16110 (ΔdprA::kan trpC2) available at BGSC and in Jörg Stülke's lab, PubMed, upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC Labs working on this gene/protein
References
Reviews
Loading
Original publications
Loading