cdaR [2018-09-21 09:57:38]

effector protein controlling CdaA diadenylate cyclase activity

Locus: BSU01760

Isoelectric point: 4.72

Molecular weight: 52.78 kDa

Protein length: 483 aa

Gene length: 1449 bp

Function: regulation of c-di-AMP synthesis

Product: effector protein controlling CdaA diadenylate cyclase activity

Essential: no

Synonyms: ybbR

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Nucleotide metabolism → Metabolism of signalling nucleotides

Gene

Coordinates: 197,027 → 198,478

The protein

Catalyzed reaction/ biological activity

• stimulates CdaA activity upon protein-protein interaction PubMed

Structure

• 2KPU (one YbbR domain, from Desulfitobacterium hafniense) PubMed

Localization

• cell membrane, oriented towards the outside PubMed

Expression and Regulation

Operons

• Genes: cdaA-cdaR-glmM-glmS
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

Additional information

• the mRNA is very stable (> 15 min) PubMed

Biological materials

Mutant

• GP999 (cdaR::cat), available in Jörg Stülke's lab
• GP985 (cdaA-cdaR::cat), available in Jörg Stülke's lab
• BKE01760 (ΔcdaR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAGCCCAGCGGTTGTTTA, downstream forward: _UP4_GAATAAAAAAGGAGCGATTA
• BKK01760 (ΔcdaR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAGCCCAGCGGTTGTTTA, downstream forward: _UP4_GAATAAAAAAGGAGCGATTA

Expression vector

• IPTG inducible expression of Strep-cdaR in E. coli: pGP2565 (in pGP172), available in Jörg Stülke's lab
• IPTG inducible expression of His-cdaR in E. coli: pGP2557 (in pET19b), available in Jörg Stülke's lab
• GP2031: cdaR-Strep aphA3, chromosomal expression in B. subtilis, for SPINE, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab. Respective plasmids: pGP1989 and pGP1992.

Antibody

• available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading