yqhY

modulator of lipid biosynthesis

Locus: BSU_24330

Isoelectric point: 4.41

Molecular weight: 14.55 kDa

Protein length: 135 aa

Gene length: 408 bp

Function: control of fatty acid biosynthesis

Product: modulator of lipid biosynthesis

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Lipid metabolism → Biosynthesis of lipids → Biosynthesis of fatty acids
• Groups of genes → Quasi-essential genes

Gene

Coordinates: 2,529,926 → 2,530,333

Phenotypes of a mutant

• the mutant readily acquires suppressor mutants that result in reduced activity of the ACCase PubMed
• the mutant forms lipophilic clusters PubMed

The protein

Protein family

• asp23 family (with YloU, according to UniProt)

Paralogous protein(s)

• YloU

Localization

• cell poles PubMed

Expression and Regulation

Operons

• Genes: accB-accC-yqhY
  Description: PubMed

  Regulation

  • expression of the operon is strongly reduced during biofilm formation PubMed

Biological materials

Mutant

• MGNA-C367 (yqhY::erm), available at the NBRP B. subtilis, Japan
• GP1468 (ΔyqhY::erm), available in Jörg Stülke's lab PubMed
• GP1765 (ΔyqhY::cat), available in Jörg Stülke's lab PubMed
• BKE24330 (ΔyqhY::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCAATTCACCTCCGTAA, downstream forward: _UP4_TAAATGGCTTAACACGAAAC
• BKK24330 (ΔyqhY::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCAATTCACCTCCGTAA, downstream forward: _UP4_TAAATGGCTTAACACGAAAC

Expression vectors

• GP1474 (chromosomal yqhY-Strep fusion, aphA3), purification from B. subtilis, for SPINE, available in Jörg Stülke's lab
• pGP1322 (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's lab
• pGP1325 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab
• pGP1496 (His-tag, purification from E. coli, in pET28a+), available in Jörg Stülke's lab
• pGP1498 (N-terminal His-tag, TEV-site, purification from E. coli, in pWH844), available in Jörg Stülke's lab

GFP fusion

• GP1471 (spc, based on pBP43), available in Jörg Stülke's lab PubMed

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

• GP1481 (spc, based on pGP1331), available in Jörg Stülke's lab

References

Loading