skfB [2018-09-21 10:36:56]

thioether bond forming radical SAM enzyme, catalyzes the first step in the maturation of spore killing factor

Locus: BSU01920

Isoelectric point: 4.93

Molecular weight: 45.59 kDa

Protein length: 410 aa

Gene length: 1230 bp

Function: maturation of spore killing factor

Product: thioether bond forming radical SAM enzyme

Essential: no

Synonyms: ybcP,ybcQ

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Coping with stress → Toxins, antitoxins and immunity against toxins
• Prophages and mobile genetic elements → Prophages → Prophage 1

Gene

Coordinates: 214,175 → 215,407

The protein

Catalyzed reaction/ biological activity

• generates a thioether bond in SkfA, which links the cysteine residue Cys4 with the α-carbon of the methionine residue Met12 PubMed

Protein family

• moaA/nifB/pqqE family (according to Swiss-Prot)

Cofactors

• contains two Fe-S clusters PubMed

Expression and Regulation

Operons

• Genes: skfA-skfB-skfC-skfE-skfF-skfG-skfH
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Spo0A: activation, PubMed, in Spo0A regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • PhoP: activation, PubMed, in PhoP regulon

  Regulation

  • expressed under conditions that trigger sporulation (Spo0A) PubMed

  Additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb 'SkfA'-specific transcript, and a weaker 6.5 kb skfA-skfB-skfC-skfE-skfF-skfG-skfH transcript

Biological materials

Mutant

• MGNA-C513 (ybcQ::erm), available at the NBRP B. subtilis, Japan
• BKE01920 (ΔskfB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAAAATCCCCCTTAAG, downstream forward: _UP4_GAAGTCAAGGCAGGGATTCA
• BKK01920 (ΔskfB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAAAATCCCCCTTAAG, downstream forward: _UP4_GAAGTCAAGGCAGGGATTCA

References

Reviews

Loading

Research papers

Loading