cwlP

cell wall hydrolase of the SP-beta prophage region,

locus: BSU_21350

pI: 8.27

mw: 252.01 kDa

protein length: 2285 aa

gene length: 6858 bp

function: cell wall turnover

product: cell wall hydrolase

essential: no

synonyms: yomI

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
• [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 2,249,154 → 2,256,011

The protein

Catalyzed reaction/ biological activity

• hydrolyzes the peptidoglycan and cell wall of ''B. subtilis'' [Pubmed|20980266]

Protein family

• transglycosylase Slt family (together with [protein|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|CwlQ]) (according to UniProt)

[SW|Domains]

• contains soluble lytic transglycosylase (SLT) and peptidase M23 domains [Pubmed|20980266]
• ten [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)

[SW|Localization]

• cell membrane (according to Swiss-Prot)

Biological materials

Mutant

• BKE21350 (Δ[gene|F43DC974DC71CB5F82DBD9B9D5ACEB49131772DB|cwlP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAGAATCACTTCCTT, downstream forward: _UP4_TAAGAGTCTGCAAAAGCAGA
• BKK21350 (Δ[gene|F43DC974DC71CB5F82DBD9B9D5ACEB49131772DB|cwlP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAGAATCACTTCCTT, downstream forward: _UP4_TAAGAGTCTGCAAAAGCAGA