You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ywrD [2019-02-27 17:30:13]
unknown, similar to gamma-glutamyltransferase (Ggt)
Genomic Context
categories
[category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]Gene
Coordinates
3,719,134 → 3,720,711
The protein
Catalyzed reaction/ biological activity
(5-L-glutamyl)-peptide + an amino acid = peptide + 5-L-glutamyl amino acid (according to Swiss-Prot), however, all evidence suggests this is a misannotation [Pubmed|19935659]Protein family
gamma-glutamyltransferase family (according to Swiss-Prot), however, all evidence suggests this is a misannotation [Pubmed|19935659]Additional information
The gene is annotated in KEGG as an ortholog of gamma-glutamyltranspeptidase EC 2.3.2.2, This enzyme is necessary to utilize glutathione (GSH) as the sulfur source. No EC annotation for this gene is available in Swiss-Prot/MetaCyc. It has been shown by Minami et al. ([Pubmed|14762019]) that ywrD mutant grows well on minimal media supplied with GSH as the sole sulfur source. In addition, His-tag purified ywrD cannot hydrolyze GSH. [Pubmed|19935659]Expression and Regulation
Operons
genes
[gene|F1DF59528E340A65A982BD7E6621DDA82C10B2B5|ywrD]
description
[Pubmed|12823818]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]regulation
expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]view in new tabBiological materials
Mutant
MGNA-B653 (ywrD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1652 NBRP B. subtilis, Japan]BKE36100 (Δ[gene|F1DF59528E340A65A982BD7E6621DDA82C10B2B5|ywrD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAAGTCCCCTTTTTT, downstream forward: _UP4_GGAGCGGCTGTGGGGATTTABKK36100 (Δ[gene|F1DF59528E340A65A982BD7E6621DDA82C10B2B5|ywrD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAAGTCCCCTTTTTT, downstream forward: _UP4_GGAGCGGCTGTGGGGATTTAReferences
12823818,25755103,14762019