Catalyzed reaction/ biological activity
an α-amino acid + an N-terminal (5-L-glutamyl)-[peptide] --> 5-L-glutamyl amino acid + N-terminal L-α-aminoacyl-[peptide] (according to UniProt)glutathione + H2O --> L-cysteinylglycine + L-glutamate (according to UniProt)an S-substituted glutathione + H2O --> an S-substitued L-cysteinylglycine + L-glutamate, however, all evidence suggests this is a misannotation [Pubmed|19935659]Protein family
gamma-glutamyltransferase family (with [protein|5C31D968E3786858B025CE02CFAC48F61700031F|Ggt], according to UniProt), however, all evidence suggests this is a misannotation [Pubmed|19935659]Structure
[PDB|2NLZ] (from B. halodurans, 38% identity)Additional information
The gene is annotated in KEGG as an ortholog of gamma-glutamyltranspeptidase EC 2.3.2.2, This enzyme is necessary to utilize glutathione (GSH) as the sulfur source. No EC annotation for this gene is available in Swiss-Prot/MetaCyc. It has been shown by Minami et al. ([Pubmed|14762019]) that ywrD mutant grows well on minimal media supplied with GSH as the sole sulfur source. In addition, His-tag purified ywrD cannot hydrolyze GSH. [Pubmed|19935659]Mutant
MGNA-B653 (ywrD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1652 NBRP B. subtilis, Japan]BKE36100 (Δ[gene|F1DF59528E340A65A982BD7E6621DDA82C10B2B5|ywrD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAAGTCCCCTTTTTT, downstream forward: _UP4_GGAGCGGCTGTGGGGATTTABKK36100 (Δ[gene|F1DF59528E340A65A982BD7E6621DDA82C10B2B5|ywrD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAAGTCCCCTTTTTT, downstream forward: _UP4_GGAGCGGCTGTGGGGATTTA