You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ywrD
unknown, similar to gamma-glutamyltransferase (
Ggt)
Molecular weight
57.32 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
3,719,134 → 3,720,711
The protein
Catalyzed reaction/ biological activity
an α-amino acid + an N-terminal (5-L-glutamyl)-[peptide] --> 5-L-glutamyl amino acid + N-terminal L-α-aminoacyl-[peptide] (according to UniProt)glutathione + H2O --> L-cysteinylglycine + L-glutamate (according to UniProt)an S-substituted glutathione + H2O --> an S-substitued L-cysteinylglycine + L-glutamate, however, all evidence suggests this is a misannotation PubMed Protein family
gamma-glutamyltransferase family (with Ggt, according to UniProt), however, all evidence suggests this is a misannotation PubMed Structure
2NLZ (from B. halodurans, 38% identity) Additional information
The gene is annotated in KEGG as an ortholog of gamma-glutamyltranspeptidase EC 2.3.2.2, This enzyme is necessary to utilize glutathione (GSH) as the sulfur source. No EC annotation for this gene is available in Swiss-Prot/MetaCyc. It has been shown by Minami et al. (PubMed) that ywrD mutant grows well on minimal media supplied with GSH as the sole sulfur source. In addition, His-tag purified ywrD cannot hydrolyze GSH. PubMed Expression and Regulation
Operons
Regulatory mechanism
Regulation
expressed in the absence of good nitrogen sources (glutamine or ammonium) (TnrA) PubMed view in new tabBiological materials
Mutant
MGNA-B653 (ywrD::erm), available at the NBRP B. subtilis, JapanBKE36100 (ΔywrD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCACAAGTCCCCTTTTTT, downstream forward: _UP4_GGAGCGGCTGTGGGGATTTABKK36100 (ΔywrD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCACAAGTCCCCTTTTTT, downstream forward: _UP4_GGAGCGGCTGTGGGGATTTA References
Loading