chromosome positioning near the pole and transport through the polar septum / antagonist of SMC complex to the origin of replication
function
chromosome positioning before asymmetric septation
product
centromer-binding protein
Genomic Context
categories
[category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation][category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]Gene
Coordinates
4,205,556 → 4,206,404
Phenotypes of a mutant
a [gene|search|whiA ][gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB] double mutant is not viable, this can be suppressed by inactivation of [gene|search|yneA ][pubmed|29378890]The protein
Catalyzed reaction/ biological activity
forms DNA bridging interactions around parS to condense DNA and earmark the bacterial chromosome for segregation [pubmed|29244022]inhibits [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] dimerization and concomitant DNA-binding activity by stimulating [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] ATPase activity [Pubmed|21235642]recruits the condensin complex to the DNA origin region [Pubmed|24440393]the dimer binds specifcally to the centromere-like ''parS'' sequence [Pubmed|25572315]Protein family
parB family (according to Swiss-Prot)Paralogous protein(s)
[protein|559DEDC9887B811EF80994526256ADC48BA51CE3|Noc] [SW|Domains]
N-terminal domain (NTD, aa 1 - 96): binds [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] [pubmed|10064607]Central DNA-binding domain (CDBD, aa 102 - 216): binds parS DNA [pubmed|16306995]C-terminal domain (CTD, aa 233 - 282): binding of non-specific DNA, dimerization, essential for DNA condensation [pubmed|29244022]Structure
[PDB|4UMK] (complex with ''parS'' DNA)[PDB|5U1G] [pubmed|28373206][PDB|5U1J] [pubmed|28373206][SW|Localization]
chromosome centromer [Pubmed|23475963]Expression and Regulation
Operons
genes
[gene|5B3DB5A796ACA48390278E60478DFF13D0074A8D|parA]-[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]
description
[Pubmed|22383849]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]regulation
repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]view in new tabBiological materials
Mutant
1S135 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S135&Search=1S135 BGSC]1S136 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S136&Search=1S136 BGSC]1S137 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S137&Search=1S137 BGSC]BKE40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTTBKK40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTTlabs
[SW|Heath Murray], Centre for Bacterial Cell Biology, Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/heath.murray homepage]References
Reviews
22934648,26706151,28075389 Original publications
17462018,16677298,12562803,10852876,10482533,9506522,8071208,17932079,21235642,26253537,9663676,11532141,15659156,18854156,9159397,8866474,9778525,16925562,1900505,9364919,9701805,12950914,14651647,19450517,19450516,14563866,23475963,21911367,24440393,24829297,24696501,25071173,25572315,25951515,26295962,28154080,28373206,28407103,29244022,16306995,29378890,30100265