btr

transcriptional activator (AraC family), (AraC family DNA-binding domain fused to FeuA-like substrate-binding domain), regulation of the feuA-feuB-feuC-ybbA operon

Locus: BSU_01640

Isoelectric point: 6.43

Molecular weight: 60.59 kDa

Protein length: 529 aa

Gene length: 1590 bp

Function: regulation of iron acquisition

Product: transcription activator (AraC family)

Essential: no

Synonyms: ybbB,yzbC

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Homeostasis → Acquisition of iron → Acquisition of iron / Other
• Metabolism → Additional metabolic pathways → Iron metabolism → Acquisition of iron / Other
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 183,414 → 185,003

The protein

Catalyzed reaction/ biological activity

• binding of a direct repeat in the feuA promoter region and transcription activation of the feuA-feuB-feuC-ybbA operon in the presence of bacillibactin or enterobactin PubMed

Protein family

• AraC family

Domains

• Fe/B12 periplasmic-binding domain (aa 268-528) (according to UniProt)

Cofactors

• enterobactin, bacillibactin (co-activators) PubMed

Effectors of protein activity

• enterobactin, bacillibactin (co-activators) PubMed

Expression and Regulation

Operons

• Genes: btr
  Description: PubMed

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon

  Regulation

  • expressed under conditions of iron starvation (Fur) PubMed

  Additional information

  • the mRNA is very stable (half-life > 15 min) PubMed

Biological materials

Mutant

• MGNA-B949 (ybbB::erm), available at the NBRP B. subtilis, Japan
• BKE01640 (Δbtr::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACGAGTAGACCACCTTTTC, downstream forward: _UP4_TGATAAATCAGGAATTTGTC
• BKK01640 (Δbtr::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACGAGTAGACCACCTTTTC, downstream forward: _UP4_TGATAAATCAGGAATTTGTC

References

Loading