spoVG

RNA-binding regulatory protein, negative effector of asymetric septation at the onset of sporulation

Locus: BSU_00490

Isoelectric point: 5.11

Molecular weight: 10.75 kDa

Protein length: 97 aa

Gene length: 294 bp

Function: cell division, control of sporulation initiation

Product: negative effector of asymetric septation

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell division → Other genes
• Information processing → RNA synthesis and degradation → RNA chaperones
• Lifestyles → Sporulation → Sporulation/ other
• Groups of genes → Phosphoproteins → Phosphorylation on a Ser residue

Gene

Coordinates: 55,866 → 56,159

The protein

Protein family

• SpoVG family (single member, according to UniProt)

Modification

• phosphorylation on (Ser-66 OR Ser-67 OR Thr-68) PubMed

Structure

• 2IA9

Additional information

• subject to Clp-dependent proteolysis upon glucose starvation PubMed

Expression and Regulation

Operons

• Genes: spoVG
  Description: PubMed

  Sigma factors

  • SigH: sigma factor, PubMed, in SigH regulon

  Regulatory mechanism

  • SinR: repression, PubMed, in SinR regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • repressed by SinR PubMed

Biological materials

Mutant

• MGNA-A082 (spoVG::erm), available at the NBRP B. subtilis, Japan
• GP2109 (spoVG::tet, available in Jörg Stülke's lab)
• BKE00490 (ΔspoVG::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAGTAGTTCACCACCTTT, downstream forward: _UP4_TAAAAAATAACCAAAAAGCA
• BKK00490 (ΔspoVG::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAGTAGTTCACCACCTTT, downstream forward: _UP4_TAAAAAATAACCAAAAAGCA

Expression vector

• pGP2331: in pBQ200, for expression in B. subtilis, available in Jörg Stülke's lab

Expression vectors

• pGP2163: expression of SpoVG-Strep by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP2310: expression of SpoVG-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

References

Loading