You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yabT [2019-01-30 09:43:08]
Ser/Thr kinase, controls
Translation and DNA integrity during spore development
Molecular weight
37.51 kDa
Function
control of DNA integrity during spore development
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
73,809 → 74,825
Phenotypes of a mutant
increased sensitivity to DNA damage during spore development PubMed The protein
Catalyzed reaction/ biological activity
Protein family
Effectors of protein activity
autophosphorylation is stimulated by non-specific binding to DNA PubMed Structure
Localization
colocalizes strongly with the septal membrane separating the mother cells from the forespore PubMed Expression and Regulation
Biological materials
Mutant
MGNA-B921 (yabT::erm), available at the NBRP B. subtilis, JapanGP577 (erm), available in Jörg Stülke's labBKE00660 (ΔyabT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT, downstream forward: _UP4_TGAATGGTGCAAACTGCAGABKK00660 (ΔyabT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT, downstream forward: _UP4_TGAATGGTGCAAACTGCAGA Expression vectors
purification from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP391, available in Jörg Stülke's labpurification from E. coli with N-terminal Strep-tag, in pGP172: pGP823, available in Jörg Stülke's lab, PubMedpurification from E. coli with N-terminal His-tag, in pWH844: pGP1408, available in Jörg Stülke's lab LacZ fusion
translational lacZ fusion (in pAC7): pGP831, available in Jörg Stülke's lab References
Reviews
Loading
Original publications
Loading