citR

transcriptional repressor of citA

Locus: BSU_09430

Isoelectric point: 8.67

Molecular weight: 35.44 kDa

Protein length: 291 aa

Gene length: 876 bp

Function: regulation of the minor citrate synthase

Product: transcriptional repressor (LysR family)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 1,020,073 → 1,020,948

The protein

Protein family

• LysR family (according to UniProt)

Domains

• HTH lysR-type domain (aa 1-58) (according to UniProt)

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: citR
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

Biological materials

Mutant

• GP1283 Δ(citR)::aphA3, available in Jörg Stülke's lab
• GP1753 Δ(citR-citA)::aphA3, the resistance cassette can be cut out by introducing the cre-rekombinase into the chromosom of B. subtilis, available in Jörg Stülke's lab
• GP2360 Δ(citR-citA)::erm, the resistance cassette can be cut out by introducing the cre-rekombinase into the chromosom of B. subtilis, available in Jörg Stülke's lab
• BKE09430 (ΔcitR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT
• BKK09430 (ΔcitR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT

Expression vectors

• pGP2264 (N-terminal His-tag, purification from E. coli, in pETM-11), available in Jörg Stülke's lab
• pGP1023 (C-terminal Strep-tag, purification from E. coli, in pGP574), available in Jörg Stülke's lab
• pGP1029 (N-terminal Strep-tag, purification from B. subtilis, in pGP380), available in Jörg Stülke's lab
• pGP1030 (C-terminal Strep-tag, purification from B. subtilis, in pGP382), available in Jörg Stülke's lab
• pGP2260 (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's lab
• pGP2262 (integration into ganA, expression under the control of the xylose-inducible PxylA promoter in B. subtilis, in pGP888), available in Jörg Stülke's lab

References

Loading