fecF [2019-04-24 13:33:30]

iron/citrate ABC transporter (ATP-binding protein)

Locus: BSU07490

Isoelectric point: 6.07

Molecular weight: 29.31 kDa

Protein length: 266 aa

Gene length: 801 bp

Function: iron uptake

Product: iron/citrate ABC transporter (ATP-binding protein)

Essential: no

E.C.: 3.6.3.-

Synonyms: yfmF

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of iron/ siderophores
• Cellular processes → Homeostasis → Acquisition of iron → ABC transporters for the uptake of iron/ siderophores
• Metabolism → Additional metabolic pathways → Iron metabolism → ABC transporters for the uptake of iron/ siderophores
• Groups of genes → Membrane proteins

Gene

Coordinates: 822,903 → 823,703

The protein

Protein family

• ABC transporter domain (according to Swiss-Prot)

Paralogous protein(s)

• FhuC, FpbP, YusV

Structure

• 4G1U (from Yersinia pestis, the FecD-FecE-FecF complex, 32% identity) PubMed

Localization

• associated to the membrane (via FecD-FecE) PubMed

Expression and Regulation

Operons

• Genes: fecC-fecD-fecE-fecF
  Description: PubMed

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon

  Regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) (Fur) PubMed

Biological materials

Mutant

• MGNA-C244 (yfmF::erm), available at the NBRP B. subtilis, Japan
• BKE07490 (ΔfecF::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAGTTTTCCCATGGTATCCT, downstream forward: _UP4_TGAAAAGGAGAGGAATTCCC
• BKK07490 (ΔfecF::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAGTTTTCCCATGGTATCCT, downstream forward: _UP4_TGAAAAGGAGAGGAATTCCC

References

Loading