lutP [2018-02-09T22:57:13.000Z]

lactate permease

Locus: BSU34190

Isoelectric point: 9.48

Molecular weight: 59.59 kDa

Protein length: 563 aa

Gene length: 1689 bp

Function: lactate uptake

Product: lactate permease

Essential: no

Synonyms: yvfH

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Transporter for organic acids
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of organic acids
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,510,780 → 3,512,471

Phenotypes of a mutant

• poor growth with lactate as single carbon source PubMed

The protein

Catalyzed reaction/ biological activity

• lactate uptake PubMed

Protein family

• lactate permease family (according to Swiss-Prot)

Paralogous protein(s)

• LctP

Localization

• membrane PubMed

Expression and Regulation

Operons

• Genes: lutP
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • ComA: activation, (ComA) PubMed, in ComA regulon
  • LutR: repression, in LutR regulon

  Regulation

  • expressed at high cell density (ComA) PubMed

Biological materials

Mutant

• MGNA-A489 (yvfH::erm), available at the NBRP B. subtilis, Japan
• BKE34190 (ΔlutP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA, downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA
• BKK34190 (ΔlutP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA, downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA

Labs working on this gene/protein

• Richard Losick, Harvard Univ., Cambridge, USA homepage

References

Loading