SubtiBank SubtiBank
ccpA
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

ccpA

Carbon catabolite control protein A, involved in glucose regulation of many genes; represses catabolic genes and activates genes involved in excretion of excess carbon
locus
BSU_29740
pI
5.06
mw
36.78 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
function
carbon catabolite repression (CCR)
product
transcriptional regulator ([SW|LacI family])
essential
no
synonyms
graR,alsA,amyR

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    Coordinates
    3,044,165 → 3,045,169

    Phenotypes of a mutant

  • Loss of carbon catabolite repression. Loss of [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI]-dependent sugar transport due to excessive phosphorylation of [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK]
  • The mutant is unable to grow on a minimal medium with glucose and ammonium as the only sources of carbon and nitrogen, respectively, this can be suppressed by mutations resulting in hyperactive [protein|41199C76DF8CA804B7B8878D61228B9542A96AE4|topoisomerase I] or in the inactivation of [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [pubmed|29242163,17183217]
  • The protein

    Catalyzed reaction/ biological activity

  • transcriptional regulator of carbon catabolite repression (CCR)
  • Protein family

  • [SW|LacI family]
  • [SW|Domains]

  • [SW|HTH lacI-type domain] (aa 1-58) (according to UniProt)
  • DNA binding Domain (6 – 25)
  • [SW|Cofactors]

  • [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]-Ser46-P, [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh]-Ser-46-P
  • Effectors of protein activity

  • glucose-6-phosphate, fructose-1,6-bisphosphate [Pubmed|17376479]
  • Structure

  • [PDB|3OQM] (complex of ''B. subtilis'' CcpA with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the ''[gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]'' operator site)
  • [PDB|3OQN] (complex of ''B. subtilis'' CcpA with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the ''[gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]'' operator site)
  • [PDB|3OQO] (complex of ''B. subtilis'' CcpA with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and a optimal synthetic operator site)
  • [PDB|2HSG] (apoprotein) [pubmed|17500051]
  • CcpA-[protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh]-DNA-complex [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=52326 NCBI]
  • complex with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and sulphate ions [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=39857 NCBI]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000022 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]-[gene|3D42584D65D80A1C73F057714647E29FF6BBD58A|motP]-[gene|6617D785D08C5919F0B774D2AF9EA6A84215486B|motS]
    description
    [Pubmed|16547058]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    additional information

  • there are about 3.000 molecules of CcpA per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/8000527 PubMed], this corresponds to a concentration of 3 µM (according to [PubMed|20408793])
  • Biological materials

    Mutant

  • QB5407 (ccpA::spc) [Pubmed|10941796], available in [SW|Jörg Stülke]'s lab
  • GP302 (erm) [Pubmed|12123463], available in [SW|Jörg Stülke]'s lab
  • GP300 (an in frame deletion of ''[gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]'') [Pubmed|11557150], available in [SW|Jörg Stülke]'s lab
  • WH649 (aphA3), available in [SW|Gerald Seidel]'s lab
  • BKE29740 (Δ[gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAAAACCACTCCTTT, downstream forward: _UP4_TAAGAAAAACAAAGAGCAAG
  • BKK29740 (Δ[gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAAAACCACTCCTTT, downstream forward: _UP4_TAAGAAAAACAAAGAGCAAG
  • Expression vectors

  • pGP643 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pWH940 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Gerald Seidel]'s lab
  • Antibody

  • available in [SW|Gerald Seidel]'s and in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Gerald Seidel], Erlangen University, Germany [http://www.biologie.uni-erlangen.de/mibi/index2.html Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
  • [SW|Milton H. Saier], University of California at San Diego, USA [http://biology.ucsd.edu/faculty/saier.html Homepage]
  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • [SW|Oscar Kuipers], University of Groningen, The Netherlands [http://molgen.biol.rug.nl/molgen/index.php Homepage]
  • References

    Reviews

  • 20408793,8598282,19202299,14665673,18628769,18359269
  • General and physiological studies

  • 1904524,10941796,12123463,8000527,18757537,16547058,14523131,22001508,22512862,29242163,30096425
  • Global analyses (proteome, transcriptome, ChIP-chip)

  • 12850135,11251851,10559165,11160890,17183215,22383848,22900538,26483775
  • Repression of target genes by CcpA

  • 15150224,16166551,11929549,7913927,17827291,11985717,12100558,7592486,16825793,16491025,21398533,26712933,28974613
  • Positive regulation of gene expression by CcpA

  • 8226682,12193635,10559153,15916605,9811655,10986270,25157083
  • Control of CcpA activity

  • 7623661,9973552,9334231,12051938,9689125
  • CcpA-DNA interaction

  • 8596444,10666464,15885105,7665492,9254709,21106498
  • Functional analysis of CcpA

  • 10383986,10601226,11557150,9252590,9988473
  • Structural analyses

  • 15369672,16316990,17376479,16755587,17500051,17401189,10666630