manA [2018-06-22 18:35:33]

mannose-6-phosphate isomerase, required for proper cell wall synthesis

Locus: BSU12020

Isoelectric point: 5.28

Molecular weight: 35.85 kDa

Protein length: 315 aa

Gene length: 945 bp

Function: mannose utilization

Product: mannose-6-phosphate isomerase

Essential: no

Synonyms: yjdE

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of mannose

Gene

Coordinates: 1,274,692 → 1,275,639

Phenotypes of a mutant

• cells lose the characteristic rod shape typical of wild type B. subtilis cells and instead appear as elongated spheres, which are significantly larger than normal PubMed

Expression and Regulation

Operons

• Genes: manP-manA-yjdF
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • ManR: activation, in the presence of mannose and absence of glucose PubMed, in ManR regulon
  • RNA switch: termination/antitermination, expession may be controlled by a potential RNA switch located in the 5' untranslated region of the manP-manA-yjdF mRNA between manA and yjdF, in RNA switch

  Regulation

  • induced by mannose (ManR) PubMed

Biological materials

Mutant

• MGNA-A265 (yjdE::erm), available at the NBRP B. subtilis, Japan
• BKE12020 (ΔmanA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AGTCGTCATGAAAATCCCCC, downstream forward: _UP4_TAACATGGCAGGGCTTGAGA
• BKK12020 (ΔmanA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AGTCGTCATGAAAATCCCCC, downstream forward: _UP4_TAACATGGCAGGGCTTGAGA

References

Loading