ftsX [2019-08-23 11:46:52]

ABC transporter (membrane protein) (FtsE-FtsX), required for CwlO activity (cell elongation) and for proper activation of Spo0A and initiation of sporulation

Locus: BSU_35250

Isoelectric point: 10.02

Molecular weight: 32.95 kDa

Protein length: 296 aa

Gene length: 891 bp

Function: control of cell wall synthesis

Product: ABC transporter (membrane protein)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Autolytic activity required for peptidoglycan synthesis (cell elongation)
• Cellular processes → Transporters → ABC transporters → Regulatory ABC transporters
• Information processing → Regulation of gene expression → phosphorelay
• Lifestyles → Sporulation → phosphorelay
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,623,938 → 3,624,828

Phenotypes of a mutant

• a ftsX mutation is synthetically lethal with a lytE mutation (due to a lack of autolysin activity) PubMed
• shorter, fatter cells, this can be rescued by addition of Mg(2+) PubMed
• reduced growth rate, especially at low Mg(2+) concentrations PubMed
• loss of genetic competence PubMed

The protein

Catalyzed reaction/ biological activity

• necessary for the autolysin activity of CwlO PubMed

Protein family

• ABC-4 integral membrane protein family (according to UniProt)

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: ftsE-ftsX
  Description: (according to DBTBS) null

  Regulatory mechanism

  • Spo0A: repression, PubMed, in Spo0A regulon

  Regulation

  • repressed under conditions that trigger sporulation (Spo0A) PubMed

Biological materials

Mutant

• GP3198 (ftsX::spc), available in Jörg Stülke's lab
• BKE35250 (ΔftsX::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTCACGCAAGTGGCGCCCGA, downstream forward: _UP4_TAAAGTGAAAAAGCCGTTCC
• BKK35250 (ΔftsX::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTCACGCAAGTGGCGCCCGA, downstream forward: _UP4_TAAAGTGAAAAAGCCGTTCC

References

Loading