rapG

response regulator aspartate phosphatase, controls DegU activity

Locus: BSU_40300

Isoelectric point: 4.81

Molecular weight: 42.68 kDa

Protein length: 365 aa

Gene length: 1098 bp

Function: control of DegU activity

Product: response regulator aspartate phosphatase

Essential: no

Synonyms: yycM

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein phosphatases
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of two-component response regulators → Response regulator aspartate phosphatase
• Information processing → Regulation of gene expression → Quorum sensing

Gene

Coordinates: 4,140,260 → 4,141,357

The protein

Catalyzed reaction/ biological activity

• control of DegU activity PubMed

Protein family

• RAP family (according to UniProt)

Domains

• six tetratrichopeptide repeats (according to UniProt)

Effectors of protein activity

• binding of PhrG to RapG prevents it from binding DegU PubMed

Structure

• 4I9E (RapF, 26% identity) PubMed

Expression and Regulation

Operons

• Genes: rapG-phrG
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigH: sigma factor, PubMed, in SigH regulon

  Regulatory mechanism

  • SinR: repression, PubMed, in SinR regulon
  • RghR: repression, PubMed, in RghR regulon
  • CcpA: repression, PubMed, in CcpA regulon

  Regulation

  • repressed by glucose (4.8-fold) (CcpA) PubMed

Biological materials

Mutant

• MGNA-B821 (yycM::erm), available at the NBRP B. subtilis, Japan
• BKE40300 (ΔrapG::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTGAAACTCCTTTCTCT, downstream forward: _UP4_ATTAAACGAACGGAGGTTAT
• BKK40300 (ΔrapG::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTGAAACTCCTTTCTCT, downstream forward: _UP4_ATTAAACGAACGGAGGTTAT

References

Loading