You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
cshA [2019-08-15 11:06:55]
DEAD-box RNA helicase, important for adaptation to low temperatures
Molecular weight
57.11 kDa
Product
DEAD-box RNA helicase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
511,106 → 512,641
Phenotypes of a mutant
The protein
Catalyzed reaction/ biological activity
RNA helicaserequired for ribosome assembly (biogenesis of the large subunit) PubMedunwind duplex RNA with or without overhangs PubMedATP + H2O --> ADP + H+ + phosphate (according to UniProt) Protein family
Paralogous protein(s)
Structure
Localization
cytoplasma, colocalizes with the ribosomes PubMed, may also associate with the cell membrane PubMed Expression and Regulation
Biological materials
Mutant
GP1035 (ΔcshA::aphA3), available in Jörg Stülke's lab PubMedGP1083 (ΔcshA::cat), available in Jörg Stülke's labBKE04580 (ΔcshA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGCBKK04580 (ΔcshA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC Expression vectors
for expression/ purification from B. subtilis with C-terminal Strep-tag, for SPINE, in pGP382: pGP1387, available in Jörg Stülke's labfor expression/ purification from B. subtilis with C-terminal Strep-tag, for SPINE, expression from the native chromomsomal site: GP1026 (aphA3), available in Jörg Stülke's labfor expression/ purification from E. coli with N-terminal His-tag, in pWH844: pGP1386, available in Jörg Stülke's lab GFP fusion
pGP1369 for chromosomal expression of CshA-YFP, available in Jörg Stülke's labB. subtilis GP1081 cshA-gfp spc, available in Jörg Stülke's lab,GP1721 (in pBP43), expression of cshA-GFP::spc under the native promoter, available in Jörg Stülke's lab PubMed Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed FLAG-tag construct
Labs working on this gene/protein
References
Reviews
Loading
Original publications
Loading