prkD [2019-02-24 18:10:01]

protein kinase D

Locus: BSU02030

Isoelectric point: 6.36

Molecular weight: 29.91 kDa

Protein length: 256 aa

Gene length: 771 bp

Function: unknown

Product: protein kinase D

Essential: no

E.C.: 2.7.11.1

Synonyms: ybdM

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Groups of genes → Phosphoproteins → Phosphorylation on a Thr residue

Gene

Coordinates: 223,219 → 223,989

The protein

Catalyzed reaction/ biological activity

• ATP + a protein = ADP + a phosphoprotein (according to Swiss-Prot)
• phosphorylates DegS on Ser-76 (in vitro) PubMed

Protein family

• protein kinase superfamily (according to UniProt)

Modification

• autophosphorylated on Thr-174 (in vitro) PubMed

Structure

• 4EQM (PknB from Staphylococcus aureus, 34% identity in the N-terminal part, aa 18 ... 174) PubMed

Biological materials

Mutant

• MGNA-B958 (ybdM::erm), available at the NBRP B. subtilis, Japan
• GP578 (aphA3), available in Jörg Stülke's lab
• BKE02030 (ΔprkD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCTGCACTTCCCTTGG, downstream forward: _UP4_CGCGAGGATCTAAACCGGGC
• BKK02030 (ΔprkD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCTGCACTTCCCTTGG, downstream forward: _UP4_CGCGAGGATCTAAACCGGGC

Expression vectors

• pGP390 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380), available in Jörg Stülke's lab
• for expression, purification in E. coli with N-terminal Strep-tag, in pGP172: pGP821, available in Jörg Stülke's lab, PubMed
• for expression, purification in E. coli with N-terminal His-tag, in pWH844: pGP1407, available in Jörg Stülke's lab

LacZ fusion

• pGP830 (in pAC7), available in Jörg Stülke's lab

References

Loading