prkD

protein kinase D

locus: BSU_02030

pI: 6.36

mw: 29.91 kDa

protein length: 256 aa

gene length: 771 bp

function: unknown

product: protein kinase D

essential: no

ec: 2.7.11.1

synonyms: ybdM

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]

Gene

Coordinates: 223,219 → 223,989

The protein

Catalyzed reaction/ biological activity

• ATP + L-seryl-[protein] --> ADP + H⁺ + O-phospho-L-seryl-[protein] (according to UniProt)
• ATP + L-threonyl-[protein] --> ADP + H⁺ + O-phospho-L-threonyl-[protein] (according to UniProt)
• phosphorylates [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|DegS] on Ser-76 (in vitro) [Pubmed|21304896]

Protein family

• [SW|protein kinase superfamily] (according to UniProt)
• [SW|Ser/Thr protein kinase family] (according to UniProt)

[SW|Domains]

• [SW|Protein kinase domain] (aa 25-256) (according to UniProt)

Modification

• autophosphorylated on Thr-174 (''in vitro'') [Pubmed|20389117]

Structure

• [PDB|4EQM] (PknB from Staphylococcus aureus, 34% identity in the N-terminal part, aa 18 ... 174) [pubmed|22701750]

Biological materials

Mutant

• MGNA-B958 (ybdM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1957 NBRP B. subtilis, Japan]
• GP578 (aphA3), available in [SW|Jörg Stülke]'s lab
• BKE02030 (Δ[gene|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|prkD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCACTTCCCTTGG, downstream forward: _UP4_CGCGAGGATCTAAACCGGGC
• BKK02030 (Δ[gene|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|prkD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCACTTCCCTTGG, downstream forward: _UP4_CGCGAGGATCTAAACCGGGC

Expression vectors

• pGP390 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
• for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP821, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
• for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1407, available in [SW|Jörg Stülke]'s lab

lacZ fusion

• pGP830 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab

References

• 20389117,12406230,21304896,24731262,25278935,22701750