pghC [2019-06-06 11:20:41]

phage-derived gamma polyglutamic acid hydrolase

locus: BSU17270

pI: 8.30

mw: 26.72 kDa

protein length: 235 aa

gene length: 708 bp

function: polyglutamic acid degradation

product: phage-derived gamma polyglutamic acid hydrolase

essential: no

synonyms: ymaC

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 1,863,448 → 1,864,155

The protein

Catalyzed reaction/ biological activity

• hydrolysis of polyglutamic acid [Pubmed|26158264]

Protein family

• UPF0714 family (according to Swiss-Prot)

Paralogous protein(s)

• [protein|FD862CE6C4A37B17714F8F8687B3266D43EF5F63|PghL], [protein|8F9DCD77660706E4D25CD7875C014F6A2B5D8123|PghZ], [protein|BA7D1D112E934B68073DFC1F76248ED6157240E3|PghB]

[SW|Domains]

• DUF867 [http://pfam.xfam.org/family/PF05908 x], [[gamma-PGA hydrolase domain]] [Pubmed|26158264]

Structure

• [PDB|3A9L] (from B. subtilis phage NIT1, 40% identity) [pubmed|22105902]

[SW|Localization]

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|DF95DED9A6E2160C151D7664C951B198EEA225E8|pghC]-[gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]
  description: [Pubmed|22383849]

Biological materials

Mutant

• BKE17270 (Δ[gene|DF95DED9A6E2160C151D7664C951B198EEA225E8|pghC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTAACTCCTTTCATA, downstream forward: _UP4_TAACAAGCAGATCAGAAGAC
• BKK17270 (Δ[gene|DF95DED9A6E2160C151D7664C951B198EEA225E8|pghC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTAACTCCTTTCATA, downstream forward: _UP4_TAACAAGCAGATCAGAAGAC

References

• 26158264,22105902