Explore the novel features of the newest release, SubtiWiki v5! It features genomic conservation, interaction of proteins with metabolites, dedicated metabolite pages, and much more!
Check the pages for MntR and manganese!

uvrB

excinuclease ABC (subunit B), required for transcription-dependent asymmetry in mutation rates of genes in the two orientations

locus: BSU_35170

pI: 5.26

mw: 76.15 kDa

protein length: 661 aa

gene length: 1986 bp

function: DNA repair after UV damage

product: excinuclease ABC (subunit B)

essential: no

synonyms: dinA,uvrA

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]

Gene

Coordinates: 3,612,945 → 3,614,930

Phenotypes of a mutant

• a [gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA] [gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB] mutant is sensitive to blue light-induced DNA damage [pubmed|30054368]
• reduced resistance towards electron beams [pubmed|31948638]

The protein

Protein family

• UvrB family (with [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd], according to UniProt)

[SW|Domains]

• [SW|Helicase ATP-binding domain] (aa 26-413) (according to UniProt)
• [SW|Helicase C-terminal domain] (aa 430-596) (according to UniProt)
• [SW|UVR domain] (aa 625-660) (according to UniProt)

Structure

• [PDB|2NMV] (bound to fluorescein-adducted DNA); [PDB|2D7D] ternary complex involving UvrB* (a C-terminal truncation of full-length UvrB), a polythymine trinucleotide and ADP [Pubmed|16426634]

[SW|Localization]

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB]-[gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]
  description: [Pubmed|22383849]

  regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|8226626], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]

  regulation

  • induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|8226626]

  additional information

  • during [protein|search|sporulation] expressed both in the forespore and the mother cell [PubMed|24118570]
  • expression is induced in the presence of Cr(VI) [pubmed|30745368]

Biological materials

Mutant

• GP3534 (Δ([gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]-[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB])::kan), available in [SW|Jörg Stülke]'s lab
• GP1175 (Δ([gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]-[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB])::ermC), available in [SW|Jörg Stülke]'s lab [pubmed|22178973]
• BKE35170 (Δ[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAATAAGCCTCCGTT, downstream forward: _UP4_CTAAAAGCGGAAGGATGATG
• BKK35170 (Δ[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAATAAGCCTCCGTT, downstream forward: _UP4_CTAAAAGCGGAAGGATGATG

References

Reviews

• 16464004,15927210,7801120,22933559

Original publications

• 8226626,9555905,16426634,21821766,24147116,21145481,25713353,30054368,31948638