skfA

spore killing factor

Locus: BSU_01910

Isoelectric point: 10.65

Molecular weight: 5.80 kDa

Protein length: 55 aa

Gene length: 168 bp

Function: killing of sister cells

Product: spore killing factor

Essential: no

Synonyms: ybcO

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Coping with stress → Toxins, antitoxins and immunity against toxins
• Prophages and mobile genetic elements → Prophages → Prophage 1

Gene

Coordinates: 213,941 → 214,108

The protein

Modification

• the mature SKF is cyclic 26-amino acid peptide that is posttranslationally modified with one disulfide and one cysteine thioether bridged to the alpha-position of a methionine PubMed, the thioether bond is generated by SkfB PubMed

Localization

• secreted (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: skfA-skfB-skfC-skfE-skfF-skfG-skfH
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Spo0A: activation, PubMed, in Spo0A regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • PhoP: activation, PubMed, in PhoP regulon

  Regulation

  • expressed under conditions that trigger sporulation (Spo0A) PubMed

  Additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb 'SkfA'-specific transcript, and a weaker 6.5 kb skfA-skfB-skfC-skfE-skfF-skfG-skfH transcript

Additional information

• the mRNA is very stable (> 15 min) PubMed

Biological materials

Mutant

• MGNA-B971 (ybcO::erm), available at the NBRP B. subtilis, Japan
• BKE01910 (ΔskfA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGTAAACCTCCTCTCA, downstream forward: _UP4_TAACATTTGAGAATAGGGAG
• BKK01910 (ΔskfA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGTAAACCTCCTCTCA, downstream forward: _UP4_TAACATTTGAGAATAGGGAG

GFP fusion

• GP1645 ymdB::spc Pskf-gfp (cat) in the NCIB3610 background, available in Jörg Stülke's lab

References

Reviews

Loading