sigH [2018-01-25 11:50:41]

RNA polymerase sigma factor SigH, not fully active in laboratory strains due to a mutation (V117A)

Locus: BSU00980

Isoelectric point: 5.15

Molecular weight: 25.30 kDa

Protein length: 218 aa

Gene length: 654 bp

Function: transcription of early stationary phase genes (sporulation, competence)

Product: RNA polymerase sigma factor SigH

Essential: no

Synonyms: spo0H

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → Transcription → Sigma factors
• Information processing → Regulation of gene expression → Sigma factors and their control → Sigma factors

Gene

Coordinates: 116,600 → 117,256

The protein

Protein family

• sigma-70 factor family (according to Swiss-Prot)

Additional information

• not fully active in laboratory strains due to a mutation (V117A) PubMed
• the poor interaction of SigH with the RNA polymerase is responsible for the poor sporulation at high salinity, this phenotype can be partially suppressed by specific mutations in SigH PubMed

Expression and Regulation

Operons

• Genes: sigH-rpmGB-secE
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • repressed during logrithmic growth (AbrB) PubMed

Biological materials

Mutant

• BKE00980 (ΔsigH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA
• BKK00980 (ΔsigH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA

Labs working on this gene/protein

• Charles Moran, Emory University, NC, USA homepage

References

Reviews

Loading

The SigH regulon

Loading

Original Publications

Loading