bdbA

thiol-disulfide oxidoreductase

Locus: BSU_21460

Isoelectric point: 8.34

Molecular weight: 16.04 kDa

Protein length: 137 aa

Gene length: 414 bp

Function: oxidative folding of proteins

Product: thiol-disulfide oxidoreductase

Essential: no

Synonyms: yolI

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Chaperones/ protein folding
• Prophages and mobile genetic elements → Prophages → SP-beta prophage
• Groups of genes → Secreted proteins

Gene

Coordinates: 2,266,936 → 2,267,349

The protein

Protein family

• Thioredoxin family (according to UniProt)

Domains

• Thioredoxin domain (aa 26-136) (according to UniProt)

Localization

• secreted (according to UniProt)

Expression and Regulation

Operons

• Genes: sunA-sunT-bdbA-yolJ-bdbB
  Description: PubMed

  Regulatory mechanism

  • Rok: repression, PubMed, in Rok regulon
  • Abh: activation, PubMed, in Abh regulon
  • DnaA: repression, Rok-DnaA PubMed, in DnaA regulon
  • YvrHb: activation, PubMed, in YvrHb regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • repressed by Rok-DnaA PubMed
  • expression starts in the stationary phase PubMed
  • expression is heterogeneous in the population, this is mediated by AbrB, Rok, and Spo0A PubMed

  Additional information

  • the mRNA is very stable (> 15 min) PubMed
  • the amount of the mRNA is substantially decreased upon depletion of RNase Y PubMed

Biological materials

Mutant

• BKE21460 (ΔbdbA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTCATATAGAATACTCCTT, downstream forward: _UP4_TTTGATAAAAATGGTGATAG
• BKK21460 (ΔbdbA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTCATATAGAATACTCCTT, downstream forward: _UP4_TTTGATAAAAATGGTGATAG

References

Loading