katX [2019-08-12 13:12:28]

catalase, general stress protein

Locus: BSU_38630

Isoelectric point: 5.34

Molecular weight: 62.19 kDa

Protein length: 547 aa

Gene length: 1644 bp

Function: detoxification (degradation) of hydrogen peroxide

Product: catalase (major catalase in spores)

Essential: no

Synonyms: yxlI

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress

Gene

Coordinates: 3,964,997 → 3,966,640

The protein

Catalyzed reaction/ biological activity

• 2 H₂O₂ = O₂ + 2 H₂O (according to Swiss-Prot)

Protein family

• catalase family (according to UniProt)

Paralogous protein(s)

• KatA, KatE

Structure

• 4CAB (from Deinococcus radiodurans, 69% identity) PubMed

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: katX
  Description: PubMed

  Sigma factors

  • SigB: sigma factor, PubMed, in SigB regulon
  • SigF: sigma factor, PubMed, in SigF regulon

  Regulatory mechanism

  • RsfA: activation, PubMed, in RsfA regulon

  Regulation

  • expressed early during sporulation in the forespore (SigF, RsfA) PubMed

Biological materials

Mutant

• MGNA-B755 (katX::erm), available at the NBRP B. subtilis, Japan
• BKE38630 (ΔkatX::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT, downstream forward: _UP4_TAACAACAGCGAACAGGGCT
• BKK38630 (ΔkatX::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT, downstream forward: _UP4_TAACAACAGCGAACAGGGCT

References

Loading