rocB

involved in arginine and ornithine utilization

Locus: BSU_37770

Isoelectric point: 5.35

Molecular weight: 64.74 kDa

Protein length: 566 aa

Gene length: 1701 bp

Function: arginine, ornithine and citrulline utilization

Product: unknown

Essential: no

Synonyms: ipa-77d

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of arginine/ ornithine

Gene

Coordinates: 3,877,192 → 3,878,892

The protein

Paralogous protein(s)

• YqjN

Expression and Regulation

Operons

• Genes: rocA-rocB-rocC
  Description: PubMed

  Sigma factors

  • SigL: sigma factor, PubMed, in SigL regulon

  Regulatory mechanism

  • CodY: repression, PubMed, in CodY regulon
  • RocR: activation, PubMed, in RocR regulon
  • AhrC: activation, PubMed, in AhrC regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Additional information

  • expression of the rocA-rocB-rocC operon is increased upon depletion of nusA (resulting from increased ahrC expression) Reference

Biological materials

Mutant

• BKE37770 (ΔrocB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAATTGTCCTCCTGATC, downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG
• BKK37770 (ΔrocB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAATTGTCCTCCTGATC, downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG

References

Loading