sucC [2019-08-01 11:16:38]

succinyl-CoA synthetase (beta subunit)

Locus: BSU_16090

Isoelectric point: 4.85

Molecular weight: 41.21 kDa

Protein length: 385 aa

Gene length: 1158 bp

Function: TCA cycle

Product: succinyl-CoA synthetase (beta subunit)

Essential: no

E.C.: 6.2.1.5

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Electron transport and ATP synthesis → ATP synthesis → Substrate-level phosphorylation
• Metabolism → Carbon metabolism → Carbon core metabolism → TCA cycle
• Groups of genes → Phosphoproteins → Phosphorylation on a Ser residue

Gene

Coordinates: 1,680,431 → 1,681,588

The protein

Catalyzed reaction/ biological activity

• ATP succinate CoA = ADP phosphate succinyl-CoA (according to Swiss-Prot)

Protein family

• succinate/malate CoA ligase beta subunit family (single member, according to UniProt)

Kinetic information

• Reversible Michaelis-Menten FEBS Letters

Modification

• phosphorylation on Ser-220 PubMed

Effectors of protein activity

• Inhibited by 2-oxoglutarate, ATP and NADH FEBS Letters
• GTP is not accepted by the enzyme FEBS Letters

Structure

• 1JKJ (E. coli)

Additional information

• extensive information on the structure and enzymatic properties of succinyl-CoA synthetase can be found at Proteopedia
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: sucC-sucD-dprA-topA
  Description: PubMed

  Regulatory mechanism

  • CcpA: repression, PubMed, in CcpA regulon

  Regulation

  • repressed by glucose (2.4-fold) (CcpA) PubMed
  • expression is heterogeneous PubMed

Other regulations

• RoxS: translation inhibition, translation inhibition and initiation of RNA degradation by Rnc

Biological materials

Mutant

• 1A1006 ∆( sucC)::spec, available at BGSC
• GP1134 (cat), available in Jörg Stülke's lab
• GP791 ∆(sucC-sucD)::tet, available in Jörg Stülke's lab
• GP2344 ∆(sucC-sucD)::kan, Cre-recombinase is integrated in sacA, available in Jörg Stülke's lab
• GP2345 ∆(sucC-sucD::lox72), Cre-recombinase is integrated in sacA, available in Jörg Stülke's lab
• BKE16090 Δ(sucC)::erm trpC2 available at BGSC, PubMed, upstream reverse: _UP1_CATTTCCCATCCTCCTAACT, downstream forward: _UP4_TAAGAAAGAATGAAAGGCAG
• BKK16090 Δ(sucC)::kan trpC2 available at BGSC, PubMed, upstream reverse: _UP1_CATTTCCCATCCTCCTAACT, downstream forward: _UP4_TAAGAAAGAATGAAAGGCAG

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Loading