You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
rnhB [2017-10-30 18:31:29]
RNase HII, endoribonuclease, responsible for removal of single rNMPs incorporated into DNA by DNA polymerase during DNA replication
Molecular weight
28.20 kDa
Function
endonucleolytic cleavage of RNA in RNA-DNA hybrid molecules
Product
Mn2 -dependent RNase HII
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,677,451 → 1,678,218
Phenotypes of a mutant
The protein
Catalyzed reaction/ biological activity
Endonucleolytic cleavage to 5'-phosphomonoester (according to Swiss-Prot)removal of single rNMPs incorporated into DNA by DNA polymerase during DNA replication PubMed Protein family
RNase HII family (according to Swiss-Prot) Localization
cytoplasm (according to Swiss-Prot)Expression and Regulation
Biological materials
Mutant
BP423 (ΔrnhB::aphA3) available in Fabian Commichau's labBKE16060 (ΔrnhB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTTCTCTTCTCCCTTAC, downstream forward: _UP4_TAAATCACCATGGACAAGGABKK16060 (ΔrnhB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTTCTCTTCTCCCTTAC, downstream forward: _UP4_TAAATCACCATGGACAAGGA Expression vector
for expression/ purification from B. subtilis with N-terminal Strep-tag, for SPINE, based on pGP380, expression from plasmid: pBP500 (E. coli amp & B. subtilis E/L) , available in Fabian Commichau's lab Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab References
Reviews
Loading
Original publications
Loading