You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
polX [2019-08-08 10:16:13]
DNA polymerase X, involved in DNA repair, generates adaptive mutations by error-prone processing of A/P sites
Molecular weight
63.95 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,923,314 → 2,925,026
The protein
Catalyzed reaction/ biological activity
template-dependent DNA polymerase, fills single nucleotide gaps PubMedhas intrinsic 3'-5' exonuclease activity for resecting unannealed 3'-termini in gapped DNA substrates PubMedhas intrinsic apurinic/apyrimidinic (AP) endonuclease activity PubMed Protein family
N-terminal part: DNA polymerase type-X family (single member, according to UniProt)C-terminal part: PHP family (single member, according to UniProt)Domains
C-terminal PHP domain with an active site formed by nine histidines and aspartates that catalyzes 3'-5' exonuclease, AP-endonuclease, 3'-phosphodiesterase and 3'-phosphatase activities PubMed Structure
3AU2 (from Thermus thermophilus, complex with dGTP, 37% identity) PubMed Expression and Regulation
Biological materials
Mutant
MGNA-B003 (yshC::erm), available at the NBRP B. subtilis, JapanBKE28590 (ΔpolX::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATCATAACCCCCAGACG, downstream forward: _UP4_TAAGTAAGGAGGCTCACACABKK28590 (ΔpolX::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATCATAACCCCCAGACG, downstream forward: _UP4_TAAGTAAGGAGGCTCACACA Labs working on this gene/protein
References
Reviews
Loading
Original publications
Loading