gtaB

UTP-glucose-1-phosphate uridylyltransferase, general stress protein

Locus: BSU_35670

Isoelectric point: 4.91

Molecular weight: 32.92 kDa

Protein length: 292 aa

Gene length: 879 bp

Function: biosynthesis of teichoic acid

Product: UTP-glucose-1-phosphate uridylyltransferase

Essential: no

E.C.: 2.7.7.9

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of teichoic acid
• Metabolism → Lipid metabolism → Lipid metabolism/ other
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of teichoic acid
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue
• Groups of genes → Phosphoproteins → Phosphorylation on either a Ser, Thr or Tyr residue

Gene

Coordinates: 3,665,629 → 3,666,507

Phenotypes of a mutant

• cells are bent and distended due to the lack of glucolipids PubMed
• the inactivation of gtaB suppresses the poor and filametous growth of the whiA zapA double mutant PubMed
• inactivation of gtaB reduces sporulation efficiency to 0.1% that of wild type cells; smaller, wider mother cells with small forespores PubMed
• resistant to phage SPO1 PubMed

The protein

Catalyzed reaction/ biological activity

• α-D-glucose 1-phosphate + H⁺ + UTP --> diphosphate + UDP-α-D-glucose (according to UniProt)

Protein family

• UDPGP type 2 family (with YngB and YtdA, according to UniProt)

Paralogous protein(s)

• YtdA, YngB

Modification

• phosphorylated on Arg-76 PubMed
• phosphorylated on ser/ thr/ tyr PubMed

Structure

• 2E3D (from E. coli, 44% identity, 61% similarity) PubMed

Expression and Regulation

Operons

• Genes: gtaB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigB: sigma factor, PubMed, in SigB regulon

  Regulation

  • induced by stress (SigB) PubMed

Biological materials

Mutant

• BKE35670 (ΔgtaB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTAAAAGGCACCTTCCT, downstream forward: _UP4_TAAACAAAAAGGCTATTGGA
• BKK35670 (ΔgtaB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTAAAAGGCACCTTCCT, downstream forward: _UP4_TAAACAAAAAGGCTATTGGA

References

Loading