You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yfjQ
minor magnesium transporter
Molecular weight
37.69 kDa
Product
minor magnesium transporter
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
871,347 → 872,306
Phenotypes of a mutant
a mgtE yfjQ mutant does not grow on rich media, this can be suppressed by the addition of 25 mM Mg2+, moreover the mutant grows well on minimal medium in the presence of citrate (due to the activity of CitM) PubMed The protein
Protein family
CorA metal ion transporter (MIT) (TC 1.A.35) family (together with CorA) (according to UniProt) Structure
4I0U (from Thermotoga maritima, 37% identity) PubMed Expression and Regulation
Biological materials
Mutant
MGNA-C274 (yfjQ::erm), available at the NBRP B. subtilis, JapanBKE08000 (ΔyfjQ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAACAACCCTCCACCTG, downstream forward: _UP4_TGAGGACAGCGAGCAGCTGTBKK08000 (ΔyfjQ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAACAACCCTCCACCTG, downstream forward: _UP4_TGAGGACAGCGAGCAGCTGTGP2853 (yfjQ::tet), available in Jörg Stülke's lab References
Loading