conE

ATPase, required for conjugation of ICEBs1, part of the type IV secretion system for DNA transfer

Locus: BSU_04940

Isoelectric point: 5.51

Molecular weight: 96.06 kDa

Protein length: 797 aa

Gene length: 2394 bp

Function: conjugative transfer of ICEBs1

Product: ATPase, part of the type IV secretion system for DNA transfer

Essential: no

Synonyms: yddE

Genomic Context

Loading

Categories containing this gene/protein

• Prophages and mobile genetic elements → Mobile genetic elements → ICEBs1
• Groups of genes → Membrane proteins

Gene

Coordinates: 538,836 → 541,229

Phenotypes of a mutant

• Defective for conjugal transfer of ICE''Bs1

The protein

Catalyzed reaction/ biological activity

• required for conjugative transfer of ICEBs1, putative ATPase PubMed

Protein family

• HerA/FtsK Superfamily of ATPases including the well-studied proteins FtsK, SpoIIIE, VirB4, and VirD4

Localization

• peripheral membrane protein (via ConB), located at the cell poles PubMed

Expression and Regulation

Operons

• Genes: xis-ydzL-ydcO-ydcP-ydcQ-nicK-S172-ydcS-ydcT-yddA-conB-conC-conD-conE-yddF-conG-cwlT-yddI-yddJ
  Description: PubMed

  Regulatory mechanism

  • ImmR: repression, PubMed, in ImmR regulon

  Regulation

  • strongly induced in the presence of salt (1.2 M NaCl) PubMed

Biological materials

Mutant

• BKE04940 (ΔconE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTTTTTATACGATTCAACTT, downstream forward: _UP4_TTGTAAAAAGGGGTTGAATC
• BKK04940 (ΔconE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTTTTTATACGATTCAACTT, downstream forward: _UP4_TTGTAAAAAGGGGTTGAATC

Labs working on this gene/protein

• Melanie Barker Berkmen, Suffolk University, Boston, MA Homepage

References

Loading